distinctive target probe (td probe) and methods for detecting a target DNA nucleic acid sequence or

专利摘要:
PROBE TD AND ITS USES. The present invention relates to a distinctive target probe (TD probe) and its uses or applications. The TD probe is hybridized to a target nucleic acid sequence via either the second 5' hybridization moiety or the first 3' hybridization moiety. When the TD probe is hybridized to a non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion do not hybridize to the non-target nucleic acid sequence such that both portions form a single strand due to the its low Tm value. As such, the TD probe exhibits distinctly different hybridization patterns of each of the target and non-target nucleic acid sequences, discriminating the target nucleic acid sequence from the non-target nucleic acid sequence with much higher specificity.
公开号:BR112012008102B1
申请号:R112012008102-0
申请日:2010-09-02
公开日:2021-05-04
发明作者:Jong Yoon Chun；In Taek Hwang；Sang Kil Lee
申请人:Seegene, Inc；
IPC主号:

专利说明:

BACKGROUND OF THE INVENTION FIELD OF THE INVENTION
[001] The present invention relates to a distinctive target probe (TD probe) and its uses or applications. DESCRIPTION OF RELATED TECHNIQUE
[002] DNA hybridization is a fundamental process in molecular biology. Many technologies using DNA hybridization are sure to be very useful instruments in target-sequence detection and will clearly be valuable in clinical diagnosis, genetic research, and forensic laboratory analysis.
[003] Recently, there have been many efforts to improve the specificity of oligonucleotide hybridization because DNA hybridization is affected by many conditions such as salt concentration, temperature, organic solvents, base composition, length of complementary strands, and the number of base mismatches nucleotides between hybridizing nucleic acids (Maniatis et al., Molecular Cloning, A Laboratory Manual, Cold Springs Harbor Laboratory, 1982 and Sambrook et al., 1989). Over the past decade, many methods have been proposed; a method of chemically modifying DNA bases for high sensitivity hybridization (Azhikina et al., (1993) Proc. Natl. Acad. Sci., USA, 90:11460-11462) and a method in which washing after hybridization is conducted at low temperatures for a long period to increase the ability to discriminate incompatibility (Drmanac et al., (1990) DNA and Cell Biology, 9:527-534). Recently, another method has been introduced to increase the resolving power of single nucleotide polymorphisms (SNPs) in DNA hybridization through artificial mismatches (Guo et al., (1997) Nature Biotechnology, 15:331-5). In addition, many US patents including U.S. Patent Nos. 6,077,668, 6,329,144, 6,140,054, 6,350,580, 6,309,824, 6,342,355 and 6,268,128 disclose the hybridization probe and its applications.
[004] Many methods have been proposed for the detection of target sequences using probes. Among these types of methods, there are several methods proposed using hybridization probes and nucleolytic enzymes. The TaqMan™ probe method is one of the typical examples of using these principles. TaqMan™ probes are oligonucleotides that contain a fluorescent dye, typically at the 5' end, and a quench dye, typically located at the 3' end. When irradiated, the excited fluorescent dye transfers energy to the nearby quenching dye molecule instead of fluorescing, resulting in a non-fluorescent substrate. TaqMan™ probes are designed to hybridize to an internal region of a PCR product. During PCR, when the polymerase replicates a template to which the TaqMan™ probes are attached, the 5' to 3' exonuclease activity of the polymerase cleaves the probes. This separates the fluorescent and quenching dyes and fluorescence resonance energy transfer (FRET) no longer occurs. Fluorescence increases with each cycle, proportional to the rate of probe cleavage. (Parashar et al, Indian J Med Res 124: 385-398 (2006)). That is, it is characteristic of the TaqMan™ probe method to utilize hybridization and cleavage reactions by the 5' to 3' nuclease activity of the polymerase. However, this technology carries an inherent limitation of its own. The most critical problem associated with the TaqMan™ probe method is non-specific hybridization of probes because it is necessarily accompanied by hybridization between the probes and target sequences. Furthermore, this method is very likely to produce false positive signals (results), especially on multiple detection of a plurality of target sequences.
[005] Another approach for detecting target sequences is to use probe binding methods (DY Wu, et al., Genomics 4:560 (1989), U. Landegren, et al., Science 241:1077 (1988), and E. Winn-Deen, et al., Clin. Chem. 37:1522 (1991)). The binding reaction is considered a promising tool for detecting point mutations. In the oligonucleotide binding assay (OLA), two probes that span a target region of interest are hybridized to the target region. Where probes are hybridized to adjacent target bases, the confronting ends of probe elements can be joined by ligation, for example, by treatment with ligase. The bound probe is indicative of the presence of the target sequence. DNA ligases are reported to catalyze the binding of DNA substrates with mismatched nucleotides at the binding site (Luo J, et al., Nucleic acid res 24:3071 (1996)). Even in binding-based target detection approaches, there also remains a need to prevent non-specific binding of probes to target sequences. Also, it is necessary that the binding reaction takes place with much higher specificity, for example, with discrimination of a single incompatible nucleotide present at a binding site.
[006] There are development needs for a useful method to detect the presence, level or expression patterns of each of a large number of a gene or a gene population simultaneously. One of the most promising methods for these purposes are microarray-based technologies (Schena et al., 1995. Quantitative Monitoring of Gene Expression Patterns with a Complementary DNA Microarray, Science, 270:467-470; DeRisi et al., 1996, Use of a cDNA Microarray to Analyze Gene Expression Patterns in Human Cancer, Nature Genetics 14:457-460). The microarray-based technologies suggested so far relate to the detection of genes or nucleotide variations and analysis of their expression models.
Microarray-based technologies generally use single-stranded oligonucleotides (nucleic acid probes) that are complementary to a specific nucleic acid sequence on the target nucleic acid. However, since conventional DNA microarrays most often rely on hybridization to detect target nucleotide sequences, they have shortcomings such as a high false-positive rate. Especially, when a large number of probes is used, the occurrence of cross hybridization events cannot be excluded. This cross-hybridization can dramatically affect data quality and cause false-positive/false-negative results. Furthermore, the microarray requires numerous liquid manipulation steps, and incubation and washing temperatures must be carefully controlled to discriminate single nucleotide incompatibility. Multiplexing in this approach has been proven to be very difficult because of the different optimal hybridization conditions between many probe sequences. (William E. Bunney, et al. 2003. Microarray Technology: A Review of New Strategies to Discover Candidate Vulnerability Genes in Psychiatric Disorders, Am. J. Psychiatry 160:4, 657-666).
[008] Although improved approaches to each method have been continuously introduced, all of these methods and techniques involving oligonucleotide hybridization cannot be completely freed from the limitations and problems that result from the non-specificity of oligonucleotide hybridization.
[009] Throughout this application, various patents and publications are referenced and citations are provided in parentheses. The disclosure of these patents and publications in their entirety is hereby incorporated by references in this patent application in order to more fully describe this invention and the state of the advanced art to which this invention belongs. SUMMARY OF THE INVENTION
[010] In such circumstances, we understand that new probes capable of specifically hybridizing to target sequences in a hybridization manner different from conventional probes must be provided to overcome disadvantages of conventional technologies. Especially, we appreciate that the new probes must have peculiar target discrimination performance in nucleolytic nuclease reactions as well as linkages.
[011] The present inventors have carried out intensive studies to develop new Target Detection technologies for detecting or identifying target nucleic acid sequences without more adequate false positive and negative results. As a result, the present inventors have designed a novel target distinctive probe that has different hybridization models for target and non-target nucleic acid sequences and therefore inherently the ability to discriminate distinctive nucleic acid sequences from non-target nucleic acid sequences. Furthermore, with the aid of new distinctive target probes, the present inventors have proposed new protocols for detecting target nucleic acid sequences plausibly applicable to both liquid and solid phase reactions.
[012] Consequently, it is an object of this invention to provide a distinctive target probe (TD probe) to allow discrimination of a target nucleic acid sequence from a non-target nucleic acid sequence.
[013] It is another object of this invention to provide a method for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe) by a 5' to 3' exonucleolytic reaction in a liquid phase or a solid phase.
[014] It is yet another object of this invention to provide a method for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe) and a polymerase chain reaction (PCR).
[015] It is a further object of this invention to provide a method to detect a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe) by a binding reaction.
[016] It is still a further object of this invention to provide sets to detect a target sequence of DNA nucleic acids or a mixture of nucleic acids.
[017] Other objects and advantages of the present invention will become apparent from the detailed description below taken in conjunction with the appended claims and drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[018] Figure 1 schematically represents the discrimination of a target nucleic acid sequence from a non-target nucleic acid sequence using a dual-labelled TD probe and an enzyme having a 5' to 3' exonuclease activity. The TD probe has a reporter molecule in its second 5' hybridization portion and a suppressor molecule in its first 3' hybridization portion.
[019] Figure 2 schematically represents the discrimination of a target nucleic acid from a non-target nucleic acid sequence using a dual-labeled TD probe and an enzyme having a 5' to 3' exonuclease activity. The TD probe has both a reporter molecule and a suppressor molecule in its second 5' hybridization portion.
[020] Figure 3 schematically represents no signal generation in a real-time PCR reaction using a template-dependent DNA polymerase having a 5' to 3' exonuclease activity when a dual-labeled TD probe having both a reporter molecule and a molecule The suppressor in its second 5' hybridization portion is hybridized to a non-target nucleic acid sequence.
[021] Figure 4 schematically represents the discrimination of a target nucleic acid sequence from a non-target nucleic acid sequence using an immobilized TD probe having a unique label and an enzyme having a 5' to 3' exonuclease activity in phase solid. Figure 4A depicts a modification of the fluorescent signal intensity on target-specific hybridization of the immobilized TD probe. Figure 4B depicts no change in fluorescent signal intensity on non-target hybridization of the immobilized TD probe.
[022] Figure 5 schematically represents the discrimination of a target nucleic acid and a non-target nucleic acid sequence using an immobilized TD probe having dual labels and an enzyme having a 5' to 3' exonuclease activity on the solid phase. Figure 5A depicts the signal generation in target-specific hybridization of the immobilized TD probe. Figure 5B depicts no signal on non-target hybridization of the immobilized TD probe.
[023] Figure 6 schematically represents the discrimination of a target nucleic acid sequence from a non-target nucleic acid sequence using a non-immobilized oligonucleotide as a single labeled first probe, a TD probe immobilized as a second labeled single probe, and a solid phase ligase. Figure 6A depicts the binding between the first probe and the second probe in target-specific hybridization. Figure 6B does not depict any binding of probes in non-target hybridization.
[024] Figure 7 schematically represents binding in target-specific hybridization using a non-immobilized oligonucleotide as a first single labeled probe, a TD probe immobilized as a second unlabeled probe, and a solid phase ligase.
[025] Figure 8 shows the results of the cleavage activity of an enzyme having a 5' to 3' exonuclease activity on incompatible 5' end probes. Symbols, 1) Template is a synthetic oligonucleotide for the Staphylococcus aureus gene; 2)Probe has a reporter molecule at its 5' end and a suppressor molecule at its 3' end portion; 3) SA_P0 has a compatible sequence at its 5' end portion; 4) SA_P1 has a single mismatched nucleotide at its 5' end; 5) SA_P3 has three mismatched nucleotides in its 5' end portion; 6) SA_P6 has six mismatched nucleotides in its 5' end portion; 7) SA_P9 has nine mismatched nucleotides in its 5' end portion.
Figure 9 shows the results of discriminating a target nucleic acid sequence from a non-target nucleic acid sequence depending on the hybridization of the second 5' hybridization portion of a dual-labeled TD probe. Figs. 9A and 9B show the detection of the Staphylococcus aureus gene and the Neisseria gonorrhoeae gene, respectively. In figure 9A, Symbols: 1) Template is a synthetic oligonucleotide for the Staphylococcus aureus gene; 2)TD probe has a reporter molecule at its 5' end and a suppressor molecule at its first 3' hybridization portion; 3) SA_TD_M has a matched sequence in its second 5' hybridization portion; 4) SA_TD_m has a mismatched sequence in its second 5' hybridization portion. In figure 9B, Symbols: 1) Template is a synthetic oligonucleotide for the Neisseria gonorrhoeae gene; 2)TD probe has a reporter molecule at its 5' end and a suppressor molecule at its first 3' hybridization portion; 3) NG_TD_M has a matched sequence in its second 5' hybridization portion; 4) NG_TD_m has a mismatched sequence in its second 5' hybridization portion.
[027] Figure 10 shows the results of comparison between a TD probe and a conventional probe for the detection of the Staphylococcus aureus gene. Symbols, 1) Template is a synthetic oligonucleotide for the Staphylococcus aureus gene; 2)Probe has a reporter molecule at its 5' end and a suppressor molecule at its 3' end portion; 3) SA_TD_M is a TD probe and has a matched sequence in its second 5' hybridization portion; 4) SA_TD_m1 is a TD probe and has three mismatched nucleotides in its second 5' hybridization portion; 5) SA_Con_M is a conventional probe and has a compatible sequence at its 5' end portion; 6) SA_Con_m1 is a conventional probe and has three mismatched nucleotides in its 5' end portion.
[028] Figure 11 shows the results of a real-time PCR reaction for the detection of a target nucleic acid sequence using a TD probe that has both a reporter molecule and a suppressor molecule in its second 5' hybridization portion. Figure 11A and 11B show the detection of the Staphylococcus aureus gene and the Neisseria gonorrhoeae gene, respectively. In figure 11A, Symbols: 1) Template is genomic DNA from Staphylococcus aureus; 2 TD probe has both a reporter molecule and a suppressor molecule in its second 5' hybridization portion; 3)SA_TD2_M has a matched sequence in its second 5' hybridization portion; 4)SA_TD2_m has a mismatched sequence in its second 5' hybridization portion. In Figure 11B, Symbols: 1) Template is Neisseria gonorrhoeae genomic DNA; 2)TD probe has both a reporter molecule and a suppressor molecule in its second 5' hybridization portion; 3)NG_TD2_M has a matched sequence in its second 5' hybridization portion; 4)NG_TD2_m has a mismatched sequence in its second 5' hybridization portion.
[029] Figure 12 shows the results of a real-time PCR reaction for discriminating a single nucleotide mismatch using a TD probe having both a reporter molecule and a suppressor molecule in its second 5' hybridization moiety. Symbols, 1) Template is genomic DNA of Staphylococcus aureus; 2)TD probe has both a reporter molecule and a suppressor molecule in its second 5' hybridization portion; 3)SA_TD_S_M has a matched sequence in its second 5' hybridization portion; 4)SA_TD_S_m has a single mismatched nucleotide in its second 5' hybridization portion.
[030] Figure 13 shows the results of discriminating a target nucleic acid sequence from a non-target nucleic acid sequence depending on the hybridization of the second 5' hybridization portion of a dual-labeled TD probe immobilized on a solid substrate surface . Each point was duplicated for reproducibility testing. Fluorescence intensity indicates the mean value of the duplicated dots. Symbols: SA_TD1_Chip_M is a TD probe having a compatible sequence in its second 5' hybridization portion; SA_TD1_Chip_m is a TD probe having a mismatched sequence in its second 5' hybridization portion.
[031] Figure 14 shows the results of the comparison between a TD probe and a conventional probe for the detection of the Staphylococcus aureus gene in solid phase. Symbols: SA_TD1_Chip_M is a TD probe having a compatible sequence in its second 5' hybridization portion; SA_TD1_Chip_m1 is a TD probe having three mismatched nucleotides in its second 5' hybridization portion; SA_Con_Chip_M is a conventional probe having a compatible sequence at its 5' end portion; SA_Con_Chip_m1 is a conventional probe having three mismatched nucleotides in its 5' end portion. DETAILED DESCRIPTION OF THIS INVENTION
[032] The present invention is designed for a distinctive target probe (TD probe) and its uses or applications. TD probes
[033] In one aspect of the present invention, a distinctive target probe (TD probe) is provided having a modified dual specificity oligonucleotide structure (mDSO) represented by the following general formula I to allow discrimination of a target nucleic acid sequence from a non-target nucleic acid sequence: 5'-X'p-Y'q-Z'r-3' (I)
[034] wherein, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased; wherein when the TD probe is hybridized to the target nucleic acid sequence, both the second 5' hybridization moiety and the first 3' hybridization moiety will be hybridized to the target nucleic acid sequence; wherein when the TD probe is hybridized with the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand, whereby the TD probe allows to discriminate the target nucleic acid sequence from non-target nucleic acid sequence.
[035] The present inventors made intensive studies to develop new Target Detection technologies for detection or identification of target sequences of nucleic acids without false positive and negative results in a more adequate way. As a result, the present inventors have designed a novel target distinctive probe that has different hybridization models for target and non-target nucleic acid sequences and therefore inherently the ability to discriminate target nucleic acid sequences from non-target nucleic acid sequences. Furthermore, with the aid of new distinctive target probes, the present inventors have proposed novel detection protocols for target nucleic acid sequences plausibly applicable to both liquid phase and solid phase reactions.
[036] Therefore, the probe used in the present invention is called a "Target Distinctive Probe" (TD probe) and the present technologies using the TD probe are called "TD probe Target Detection Assay".
[037] The TD probe of the present invention has the structure of modified dual specificity oligonucleotide (mDSO) comprising three different portions with distinct properties within an oligonucleotide molecule: second 5' hybridization portion, first 3' hybridization portion and portion of separation. Such a structure allows the TD probe to serve as a probe that exhibits much higher specificity, making the present invention new and not obvious over the prior art.
[038] The mDSO structure is a recently modified version of a DSO (dual specificity oligonucleotide) structure that was first proposed by the present inventor (see WO 2006/095981). The structure of DSO is also called DPO (dual preparation oligonucleotide) as it serves as primers (Chun et al., Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene, Nucleic Acid Research, 35:6e40 (2007)).
[039] The DSO embodies a novel concept in which its hybridization or annealing is doubly determined by a high Tm 5' specificity portion (or 5' first hybridization portion, 5' first preparation portion) and 3' specificity portion of low Tm (or the second 3' hybridization moiety, second 3' preparation moiety) separated by the separation moiety, exhibiting dramatically increased hybridization specificity (see WO 2006/095981; Kim et al., Direct detection of lamivudine-resistant hepatitis B mutant viruses by multiplex PCR using dual-priming oligonucleotide primers, Journal of Virological Methods, 149:76-84 (2008); Kim, et. al., Rapid detection and identification of 12 respiratory viruses using a dual priming oligonucleotide system-based multiplex PCR assay, Journal of Virological Methods, doi:10.1016/j.jviromet.2008.11.007(2008); Horii et. al., Use of dual priming oligonucleotide system to detect multiplex sexually transmitted pathogens in clinical specime ns, Letters in Applied Microbiology, doi:10.111/j.1472-765X2009.02618x(2009)). As such, DSO consequently has two segments with distinct hybridization properties: the first 5' hybridization portion which initiates stable hybridization, and the second 3' hybridization portion which primarily determines target specificity.
[040] The structure of mDSO is a reversal of the structure of DSO: the second 5' hybridization moiety that mainly determines the target specificity, and the first 3' hybridization moiety that initiates the stable hybridization.
[041] Where the TD probe having the structure of mDSO is hybridized to non-target sequences, its 5' end portion rather than the 3' end portion is not involved in hybridization, which is distinctly different from the DSO structure previously suggested by present inventor.
[042] To completely overcome problems associated with false positive signals particularly associated with probes, the present inventors have made intensive efforts to propose more reliable and accurate approaches in which signal generation indicative of target sequences is performed not only by hybridization probe but also additional enzymatic reactions such as 5' to 3' exonuclease reaction and ligation of two probes. Considering that the new approaches rely heavily on hybridization of the 5' end portion of probes, the present inventors have designed probes that are capable of exhibiting maximized 5' end specificity performance and modified the known DSO to propose the TD probe.
[043] The TD probe with 5 peculiar '-end hybridization models' allows the detection of target sequences without false-positive signals, which was not performed by conventional probes and DSO probes.
[044] The hybridization specificity (or target specificity) of the TD probe due to the structure of mDSO contributes to the False-free Target Detection in the present invention.
[045] Interestingly, the TD probe having the structure of mDSO exhibits distinctly different hybridization behaviors for each of the target and non-target nucleic acid sequences. As schematically depicted in Figs. 1-3, when the TD probe is hybridized to a target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion of the TD probe form a double stranded with the target nucleic acid sequence . Where the TD probe is hybridized to a non-target nucleic acid sequence (i.e., non-target hybridization or ligation), its first 3' hybridization moiety often binds to the non-target nucleic acid sequence but both the second 5' hybridization moiety as far as the separating portion is hybridized to the non-target nucleic acid sequence such that both portions form a single strand.
[046] While the first 3' hybridization portion is annealed to a non-target sequence, the second 5' hybridization portion having a shorter sequence (low Tm value) will likely not hybridize to the non-target sequence under target-hybridization condition. specific TD probe. The reasons are that the first 3' hybridization portion and the second 5' hybridization portion are separated by the separation portion in terms of hybridization events. In other words, the second 5' hybridization moiety is involved in hybridization events relatively independently of the first 3' hybridization moiety and hybridization of the second 5' hybridization moiety is less affected by hybridization of the first 3' hybridization moiety. '. In this connection, the probability of hybridization of the second 5' hybridization moiety to a non-target sequence becomes much lower.
[047] Where both the first 3' hybridization portion and the second 5' hybridization portion of the TD probe have a sequence complementary to a template, the TD probe can be specifically hybridized to the target nucleic acid sequence of the template under hybridization condition target-specific. However, where only the second 5' hybridization portion of the TD probe has a sequence complementary to a template, the TD probe cannot be hybridized to the template under target-specific hybridization condition.
[048] The characteristics of the TD probe described above allow to detect target sequences with dramatically increased target specificity by the following two target surveillance events. First, the TD probe having different hybridization templates of each of the target and non-target nucleic acid sequences as described above is capable of discriminating target nucleic acid sequences from non-target nucleic acid sequences with much higher specificity. Second, the occurrence of successive enzymatic reactions (exonucleolytic reaction or 5' to 3' binding) is determined depending on the TD probe hybridization patterns, elevating the target specificity in the Target Detection procedures.
[049] The TD probe is hybridized with a target nucleic acid sequence and forms a double strand. As discussed further above, the TD probe having the mDSO structure with such a curious design allows to perfectly discriminate target nucleic acid sequences from non-target nucleic acid sequences.
[050] According to a preferred embodiment, the universal base in the separating portion is selected from the group consisting of deoxynosine, inosine, 7-deaza-2'-deoxynosine, 2-aza-2'-deoxynosine, 2'- OMe inosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-OMe 3-nitropyrrole, 2'-F 3-nitropyrrole, 1-(2'-desoxy-beta-D-ribofuranosyl)-3 -nitropyrrole, deoxy 5-nitroindole, 5-nitroindole, 2'-OMe 5-nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-aminobenzimidazole, 4-aminobenzimidazole, deoxy nebularine, 2 '-F nebularine, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA-nebularine, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, morpholino-5-nitroindole, morpholino-nebularine, morpholino -inosine, morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebularine, phosphoramidate-inosine, phosphoramidate-4-nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-0-methoxyethyl inosine, 2 '-0-methoxyethyl l nebularin, 2'-O-methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitro-benzimidazole, 2'-O-methoxyethyl 3-nitropyrrole and combinations thereof. More preferably, the universal base is deoxynosine, 1-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole or 5-nitroindole, most preferably deoxynosine.
[051] Preferably, the separating portion comprises nucleotides having at least three, more preferably at least four, even more preferably at least five universal bases. More preferably, the separating portion comprises contiguous nucleotides having at least three, more preferably at least four, even more preferably at least five universal bases. Alternatively, the separating portion comprises 3-10, 3-8, 4-7 or 4-5 contiguous universal bases.
[052] Preferably, the first 3' hybridization portion is longer than the second 5' hybridization portion. The first 3' hybridization portion is preferably 15 to 60 nucleotides, more preferably 15 to 40 nucleotides, even more preferably 15 to 30 nucleotides in length.
[053] Preferably, the second 5' hybridization portion is at least 3, more preferably 5 and even more preferably 6 nucleotides in length. Preferably, the second 5' hybridization moiety is no more than 15, more preferably no more than 13 and even more preferably no more than 12 nucleotides in length.
[054] It is preferred that the second 5' hybridization portion is 3 to 15 nucleotides, more preferably 3 to 13 nucleotides, even more preferably 4 to 12 nucleotides and even more preferably 5 to 11 nucleotides in length. The separating portion is preferably 3 to 10 nucleotides, more preferably 3 to 8 nucleotides, even more preferably 4 to 7 nucleotides, even more preferably 4 to 5 nucleotides in length. The length of both the second 5' hybridization portion and the separation portion is preferably at least six, more preferably at least nine, even more preferably at least twelve and most preferably at least fifteen nucleotides.
[055] According to a preferred embodiment, the Tm of the first 3' hybridization portion ranges from 40°C to 80°C, more preferably 45°C to 70°C. The Tm of the second 5' hybridization moiety preferably ranges from 6°C to 40°C and more preferably from 10°C to 40°C. The Tm of the separating portion preferably ranges from 2°C to 15°C and more preferably 3°C to 15°C.
[056] According to a preferred embodiment, the TD probe has a tag or an interactive tag system containing a plurality of tags to generate a detectable signal indicative of target nucleic acid sequences.
[057] The tag that generates a detectable signal useful in the present invention includes any tag known to one of skill in the art. Some tags are composed of a single molecule or a single atom tag; however most tags (eg interactive tagging system) are composed of at least two or more tag molecules or atoms.
[058] According to a preferred embodiment, the label on the TD probe is a chemical label, an enzymatic label, a radioactive label, a fluorescent label, a luminescent label, a chemiluminescent label or a metallic (eg gold) label.
[059] Chemical labeling includes biotin. The binding specificity of biotin to streptavidin (or avidin) allows indirect signal generation indicative of target nucleic acid sequences.
[060] Enzyme labeling includes alkaline phosphatase, β-galactosidase, β-glycosidase, luciferase, cytochrome P450, and horseradish peroxidase. Using substrates for the enzymatic labels, signal indicative of target nucleic acid sequences can be obtained. Where using alkaline phosphatase, bromochloroindolylphosphate (BCIP), nitrotetrazolium blue (NBT) or ECF can be used as a substrate for color development reactions in case of using horseradish peroxidase, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin , lucigenin (bis-N-methylacridinium nitrate), resorufin benzyl ether, luminol, Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (3.3 ,5,5-tetramethylbenzidine), ABTS (2,2-Azine-di[3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD) or naphthol/pyronine can be used as a substrate; and in case of using glucose oxidase, t-NBT (nitrotetrazolium blue) or m-PMS (phenazine methosulfate) can be used as a substrate.
[061] Radiolabelling includes C14, I125, P32 and S35.
[062] According to a preferred embodiment of the present invention, the tag linked to the TD probe is a unique tag capable of providing the signal in real time. For example, the unique label is fluorescent terbium chelate (Nurmi et al, Nucleic Acids Research, 2000, Vol. 28 N. 8). Nurmi et al. revealed that the label emits low level fluorescence in a probe-bound form, but when the label is released from the duplex probe template by 5' to 3' nucleolytic activity, the fluorescence signal is increased. Therefore, the fluorescent terbium chelate allows for real-time Target Detection although a single tag is attached to the TD probe for the present invention.
[063] The interactive labeling system is a signal generation system in which energy is non-radioactively passed between a donor molecule and an acceptor molecule.
[064] As a representative of the interactive labeling system, the FRET (fluorescence resonance energy transfer) labeling system includes a fluorescent reporter molecule (donor molecule) and a suppressor molecule (acceptor molecule). In FRET, the energy donor is fluorescent, but the energy acceptor can be fluorescent or non-fluorescent.
[065] In another form of interactive marking systems, the energy donor is non-fluorescent, eg a chromophore, and the energy acceptor is fluorescent. In yet another form of interactive marking systems, the energy donor is luminescent, eg, bioluminescent, chemiluminescent, electrochemiluminescent, and the acceptor is fluorescent.
[066] More preferably, the TD probe labeling are interactive labeling systems, even more preferably the FRET labeling system, even more preferably a pair of a reporter molecule and a suppressor molecule.
[067] Preferably, where the FRET tag is used, two tags (a reporter molecule and a suppressor molecule positioned on the TD probe) are separated by a site within the TD probe susceptible to nuclease cleavage, whereby allowing the activity of 5' to 3' exonuclease separate the reporter molecule from the suppressor molecule by cleavage at the susceptible site thereby obtaining the signal indicative of the presence of the target nucleic acid sequence.
[068] The tag can be connected to the TD probe according to conventional methods. For example, the tag can be attached to the TD probe through a spacer containing at least three carbon atoms (e.g., 3-carbon spacer, 6-carbon spacer, or 12-carbon spacer).
[069] According to a preferred embodiment, the reporter molecule and the suppressor molecule are all positioned on the second 5' hybridization portion or the reporter molecule and the suppressor molecule are each positioned on each different portion of the second hybridization portion 5 ' and the separation portion. For example, the reporter molecule is positioned on the second 5' hybridization portion and the suppressor molecule on the separation portion. Alternatively, the suppressor molecule is positioned on the second 5' hybridization portion and the reporter molecule on the separation portion.
[070] More preferably, one of the reporter molecule and the suppressor molecule is located at the 5' end of the TD probe and the other located at a site of the second 5' hybridization moiety.
[071] According to a preferred embodiment, the TD probe has one of the reporter molecule and the suppressor molecule in its second 5' hybridization portion and another in its first 3' hybridization portion.
[072] More preferably, one of the reporter molecule and the suppressor molecule is located at the 5' end of the TD probe and the other located at a site of the first 3' hybridization moiety.
[073] The TD probe of the present invention has a wide variety of applications for target sequence detection as follows: 1. Target Detection Process by 5' to 3' Exonucleolytic Reaction in a Liquid Phase or in a Solid Phase 1 . Target Detection Process in a Liquid Phase
[074] The TD probe of the present invention exhibits excellent performance in target sequence detection.
[075] In another aspect of the present invention, a method is provided for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe), comprising the steps of: (a) hybridizing the target nucleic acid sequence to the TD probe having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I)
[076] wherein, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe is double labeled with a fluorescent reporter molecule and a quencher molecule capable of quenching the reporter molecule's fluorescence; at least one of the reporter molecule and the suppressor molecule is positioned over the second 5' hybridization portion; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased;
[077] wherein when the TD probe is hybridized with the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion will be hybridized with the target nucleic acid sequence and the second portion of 5' hybridization will be digested by an enzyme having a 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand such that the second 5' hybridization portion is not digested by the enzyme having activity a 5' to 3' exonuclease, whereby the TD probe makes it possible to discriminate target nucleic acid sequence from non-target nucleic acid sequence; (b) contacting the resultant of step (a) to the enzyme having 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the target nucleic acid sequence, the second 5' hybridization portion is digested by the enzyme having 5' to 3' exonuclease activity to separate the fluorescent reporter molecule from the suppressor molecule in the TD probe, resulting in generation of a fluorescence signal; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, the second 5' hybridization portion is not digested by the enzyme having 5' to 3' exonuclease activity, resulting in no fluorescence signal; and (c) detecting the fluorescence signal, such that the fluorescence signal generated by digestion at the second 5' hybridization portion is indicative of the presence of the target nucleic acid sequence.
[078] According to the present invention, the TD probe is hybridized with the target nucleic acid sequence.
[079] According to the present invention, the target nucleic acid sequence can be detected only using the TD probe and the enzyme having 5' to 3' exonuclease activity without false-positive signals, which is first proposed by the present inventors.
[080] As depicted in Figure 1, the TD probe exhibits distinctly different hybridization behaviors from each of the target and non-target nucleic acid sequences. When the TD probe is hybridized to the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion of the TD probe form a double stranded with the target nucleic acid sequence. In contrast, where the TD probe is hybridized to a non-target nucleic acid sequence (i.e., non-target hybridization or ligation), its first 3' hybridization portion often binds to the non-target nucleic acid sequence but both the second portion 5' hybridization sequences such as the separating portion of the TD probe are not hybridized to the non-target nucleic acid sequence such that both portions form a single strand.
[081] Consequently, where the TD probe is hybridized to the target nucleic acid sequence, its second 5' hybridization portion is digested by the enzyme having 5' to 3' exonuclease activity (eg, a dependent nucleic acid polymerase a template having a 5' to 3' exonuclease activity) and the fluorescent reporter molecule and the suppressor molecule are separated from each other to generate the fluorescence signal from the target nucleic acid sequence. Generally, digestion of the TD probe occurs initially at its 5' end and later in the 5' to 3' direction.
[082] In contrast, where the TD probe is hybridized to a non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion form a single strand that is not digested by the 5' to 3 exonuclease activity ' of the enzyme. Finally, the TD probe does not generate any signal on non-target hybridization.
[083] By such unique hybridization behaviors of the TD probe, the target nucleic acid sequence can only be detected using the TD probe and the enzyme having 5' to 3' exonuclease activity without false signals.
[084] According to a preferred embodiment, the enzyme having 5' to 3' exonuclease activity used acting only at the 5' end of double-stranded nucleic acids and catalyzes the exonucleolytic reaction in a 5' to 3' direction, without digestion of single-stranded nucleic acids.
[085] According to a preferred embodiment, the enzyme having 5' to 3' exonuclease activity is a thermostable enzyme. According to a preferred embodiment, the enzyme having 5' to 3' exonuclease activity is a template-dependent nucleic acid polymerase, more preferably a thermostable template-dependent nucleic acid polymerase.
[086] According to a preferred embodiment, the fluorescent reporter molecule and the suppressor molecule are each positioned over each different portion of the second 5' hybridization portion and the first 3' hybridization portion. For example, the fluorescent reporter molecule can be positioned on the second 5' hybridization moiety and the suppressor molecule on the first 3' hybridization moiety. Alternatively, the suppressor molecule can be positioned on the second 5' hybridization moiety and the fluorescent reporter molecule on the first 3' hybridization moiety.
[087] According to a preferred embodiment, the fluorescent reporter molecule and the suppressor molecule are all positioned on the second 5' hybridization portion or the reporter molecule and the suppressor molecule are each positioned on each different portion of the second hybridization portion 5' and the separating portion. Even more preferably, the fluorescent reporter molecule and suppressor molecule are all positioned over the second 5' hybridization portion of the TD probe.
[088] It is known that some enzymes (including template-dependent nucleic acid polymerases) having 5' to 3' exonuclease activity also have endonuclease activity which is generally very low. The extent of endonuclease activity can be affected by (i) types of enzymes, (ii) reaction conditions such as temperature, reaction time and reaction composition, (iii) length, sequence and 5' sequence length of incompatibility of probes or (iv) target sequences. According to a preferred embodiment, where the present method uses enzymes that have both 5' to 3' exonuclease activity and endonuclease activity, it is carried out under conditions sufficient to protect the endonuclease activity. Preferably, the present invention is carried out using enzymes having 5' to 3' exonuclease activity and little or no endonuclease activity.
[089] Therefore, endonuclease activity is not a considerable factor in Target Detection using TD probes with an enzyme having 5' to 3' exonuclease activity and endonuclease activity. However, for more defined Target Detection, a blocker can be incorporated into the first 3' hybridization portion of the TD probe to block a digestion catalyzed by the endonuclease activity of the first 3' hybridization portion of the TD probe hybridized to a non-target sequence of nucleic acids. Particularly when the TD probe is used in a liquid phase, the fluorescent reporter molecule and the suppressor molecule can all be positioned over the second 5' hybridization portion of the more defined Target Detection TD probe.
[090] In the present invention, the enzyme having a 5' to 3' exonuclease activity generally includes enzymes having a 5' to 3' exonuclease activity and usually includes enzymes having an additional endonuclease activity as well as the 5' exonuclease activity to 3'. In the present invention, template-dependent nucleic acid polymerase having a 5' to 3' exonuclease activity generally includes nucleic acid polymerases having a 5' to 3' exonuclease activity and usually includes nucleic acid polymerases having an endonuclease activity additional as well as 5' to 3' exonuclease activity.
[091] According to a preferred embodiment, the TD probe comprises at least one label anywhere in a sequence comprising 1 to 10 nucleotides from its 5' end, even more preferably, any site in a sequence comprising 1 to 5 nucleotides from the its 5' end, even more preferably any site of a sequence comprising 1 to 3 nucleotides from its 5' end. Even more preferably, the TD probe comprises at least one label at its 5' end.
[092] According to a preferred embodiment, step (a) is performed using the TD probe in conjunction with an upstream primer to be hybridized with a site downstream of a hybridized site of the TD probe and the enzyme having exonuclease activity 5' to 3' is a template-dependent nucleic acid polymerase having 5' to 3' exonuclease activity such that the upstream primer is extended by the template-dependent nucleic acid polymerase in step (b).
[093] After hybridization, upstream primer hybridized to the target nucleic acid sequence is extended by the polymerase activity of the template-dependent nucleic acid polymerase and the TD probe is digested by the 5' to 3' exonuclease activity to separate the fluorescent reporter molecule and suppressor molecule generating the fluorescence signal.
[094] According to a preferred embodiment, step (a) is performed using the TD probe in conjunction with an antisense primer and the enzyme having 5' to 3' exonuclease activity is a template-dependent nucleic acid polymerase having 5' to 3' exonuclease activity such that step (b) produces the target nucleic acid sequence hybridizable to the TD probe by a template-dependent nucleic acid polymerase antisense primer extension reaction.
[095] The antisense primer produces additional target nucleic acid sequences to be hybridized with the TD probe, resulting in obtaining clearer and higher fluorescence signals indicative of the target nucleic acid sequences.
[096] The reporter molecule and the suppressor molecule useful in the present invention may be fluorescent materials. Reporter molecules and suppressor molecules known in the art are useful in this invention. Examples of those are: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™ (531), Calcium Green ™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY 558/568 (568), BODIPY564/570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576) , Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615 ), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), R-phycocyanin (642), C-Phycocyanin (648), TO-PRO™ -3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL F luor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The numeric in parenthesis is a maximum emission wavelength in the nanometer.
[097] Appropriate pairs of suppressors by the reporter are revealed in a variety of publications as follows: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R.P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition, Molecular Probes, Eugene, Oreg., 1996; U.S. Patent Nos. 3,996,345 and 4,351,760.
[098] It is noteworthy that a non-fluorescent black quencher molecule capable of quenching a fluorescence of a wide range of wavelengths or a specific wavelength can be used in the present invention. Examples of those are BHQ and DABCYL.
[099] In the TD probe-adapted FRET tag, the reporter encompasses a FRET donor and the suppressor encompasses another FRET partner (acceptor). For example, a fluorescein dye is used as the reporter and a rhodamine dye as the suppressor.
The term used in this application "target nucleic acid", "target nucleic acid sequence" or "target sequence" refers to a nucleic acid sequence of interest for detection, which is annealed to or hybridized to a primer or probe under hybridization, annealing or amplification conditions.
[0101] The term "probe" used in this application refers to a single-stranded nucleic acid molecule that comprises a portion or portions that are substantially complementary to a target nucleic acid sequence. The probes of this invention can be comprised of naturally occurring dNMP (i.e., moisture, dGM, dCMP and dTMP), modified nucleotide, or non-natural nucleotide. Probes can also include ribonucleotides.
[0102] Preferably, the 3' end of the labeled probe is blocked to prevent extension of the probe. Blocking can be achieved using non-complementary bases or by adding a chemical moiety such as biotin or a phosphate group to the 3'-hydroxyl of the last nucleotide. Blocking can also be achieved by removing the 3'-OH or using a nucleotide without a 3'-OH, such as a dideoxynucleotide.
[0103] The term "primer" as used in this application refers to an oligonucleotide, which is capable of acting as an initiation point of synthesis when placed under conditions in which the synthesis of the primer extension product that is complementary to a nucleic acid strand (template) is induced, that is, in the presence of nucleotides and a polymerization agent, such as DNA polymerase, and at a suitable temperature and pH. The primer is preferably single-stranded for maximum amplification efficiency. Preferably, the primer is an oligodeoxyribonucleotide. The primer of this invention can be comprised of naturally occurring dNMP (i.e., moisture, dGM, dCMP and dTMP), modified nucleotide, or non-natural nucleotide. The primer can also include ribonucleotides.
[0104] The initiator must be long enough to initiate the synthesis of extension products in the presence of the polymerization agent. The exact length of the initiators will depend on many factors, including temperature, application and initiator source. The term "annealing" or "initiating" as used in this application refers to the juxtaposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, whereby the juxtaposition allows the polymerase to polymerize nucleotides into a nucleic acid molecule that is complementary to the acid. template nucleic acid or a portion thereof.
[0105] The term "hybridization" used in this application refers to the formation of double-stranded nucleic acid from complementary single-stranded nucleic acids. There is no desired distinction between the terms "annealing" and "hybridization", and these terms will be used interchangeably.
[0106] The annealing or hybridization of the TD probe can be a wide variety of hybridization procedures known to those skilled in the art. Suitable hybridization conditions in the present invention can be routinely determined by optimization procedures. Conditions such as temperature, concentration of components, hybridization and wash time, buffer components, and their pH and ionic strength can be varied depending on a number of factors including the length and GC content of oligonucleotides such as probes and sequences nucleic acid target. Detailed conditions for hybridization can be found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); and M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y. (1999).
[0107] According to a preferred embodiment, the TD probe hybridization temperature ranges from approximately 40°C to 80°C, more preferably 45°C to 75°C, even more preferably 50°C to 72°C.
[0108] The term used in this application "upstream primer" refers to a primer to be hybridized to a site downstream of a TD probe hybridized site and to form a sequence complementary to the target nucleic acid sequence with the aid of template-dependent nucleic acid polymerase.
[0109] The TD probe, upstream primer and antisense primer each have a hybridizing nucleotide sequence complementary to the target nucleic acid sequence. The term "complementary" is used in this application to mean that the primers or probes are sufficiently complementary to selectively hybridize to a target nucleic acid sequence under designated annealing conditions or stringent conditions, encompassing the terms "substantially complementary" and "perfectly complementary ", preferably perfectly complementary.
[0110] According to a preferred embodiment, the second 5' hybridization portion of the TD probe is complementary to the target nucleic acid sequence. In other words, the second 5' hybridization moiety can have a perfect match sequence or imperfect match sequence to the target nucleic acid sequence. If necessary, the second 5' hybridization portion can be designed to have some incompatible nucleotides.
[0111] According to a specific embodiment of this invention, the second 5' hybridization portion of the TD probe may have one to three additional mismatched nucleotides at its 5' end. Among enzymes (eg, nucleic acid polymerases) having 5' to 3' exonuclease activity, there were enzymes reported to be able to digest one to three nucleotides from the 5' end of oligonucleotides hybridized to target sequences (see Murante et al. , Journal of Biological Chemistry Vol. 269, 1191-1196 (1994) and Example 1). Where such enzymes are used, the TD probe can be constructed to have one to three artificial mismatched nucleotides at its 5' end.
[0112] The target nucleic acid sequence to be detected in the present invention includes any nucleic acid molecule, for example, DNA (gDNA and cDNA) and RNA. The target nucleic acid sequence includes any naturally occurring prokaryotic, eukaryotic (e.g., protozoan and parasite, fungi, yeast, higher, lower, and higher animals, including mammals and human) or viral (e.g., viruses) nucleic acid of Herpes, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, polio virus, etc.) or viroid.
[0113] The target nucleic acid sequences in a sample can be DNA or RNA. The molecule can be in double-stranded or single-stranded form. Where the nucleic acid starting material is double-stranded, it is preferable to provide both strands in a single-stranded or partially single-stranded form. Known methods for separating strands include, but are not limited to, heat treatment, alkali, formamide, urea and glycoxal, enzymatic methods (eg, helicase action), and binding proteins. For example, tape separation can be achieved by heating at a temperature ranging from 80°C to 105°C. General methods for performing this treatment are provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001).
[0114] Where an mRNA is employed as the starting material, a reverse transcription step is required prior to carrying out the annealing step, details of which are found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); and Noonan, K.F. et al., Nucleic Acids Res. 16:10366 (1988)). For reverse transcription, a random hexamer or dT oligonucleotide primer hybridizable to a polytail A mRNA is used. The dT oligonucleotide primer is comprised of dTMPs, one or more of which can be substituted with other dNMPs as long as the dT primer can serve as a primer. Reverse transcription can be done with reverse transcriptase which has RNase H activity. If using an enzyme having RNase H activity, it may be possible to omit a separate RNase H digestion step by carefully choosing the reaction conditions.
[0115] The probes or primers used in the present invention are hybridized or annealed to sites in the target nucleic acid sequences (such as templates) where the double-stranded structure is formed. Suitable nucleic acid hybridization or annealing conditions to form such double-stranded structures are described by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).
[0116] According to a preferred embodiment, the upstream primer and/or the antisense primer have a dual specificity oligonucleotide (DSO) structure represented by the following general formula II: 5'-Xp-Yq-Zr-3 '(II)
[0117] wherein, Xp represents a first 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid; Yq represents a separation moiety comprising at least three universal bases, Zr represents a second 3' hybridization moiety having a hybridization nucleotide sequence complementary to the target nucleic acid; p, q and r represent the number of nucleotides, and X, Y and Z are deoxyribonucleotides or ribonucleotides; the Tm of the first 5' hybridization portion is higher than that of the second 3' hybridization portion and the separating portion has the lowest Tm in all three portions; the separating portion separates the first 5' hybridization portion from the second 3' hybridization portion in terms of hybridization events to the target nucleic acid, whereby the hybridization specificity of the oligonucleotide is doubly determined by the first 5' hybridization portion and the second 3' hybridization portion such that the total hybridization specificity of the oligonucleotide is increased.
[0118] Descriptions of the DSO structure can be made with reference to those of the mDSO structure.
[0119] Preferably, in the DSO framework, the first 5' hybridization portion is longer than the second 3' hybridization portion. The first 5' hybridization portion is preferably 15 to 60 nucleotides, more preferably 15 to 40 nucleotides, even more preferably 15 to 25 nucleotides in length. It is preferred that the second 3' hybridization portion is 3 to 15 nucleotides, more preferably 5 to 15 nucleotides, even more preferably 6 to 13 nucleotides in length. The separating portion is preferably 3 to 10 nucleotides, more preferably 4 to 8 nucleotides, even more preferably 5 to 7 nucleotides in length. According to a preferred embodiment, the Tm of the first 5' hybridization portion ranges from 40°C to 80°C, more preferably 45°C to 65°C. The Tm of the second 3' hybridization moiety preferably ranges from 10°C to 40°C. It is preferred that the Tm of the separating portion ranges from 3°C to 15°C.
Preferably, the enzyme having 5' to 3' exonuclease activity and the template-dependent nucleic acid polymerase having 5' to 3' exonuclease activity used in the present invention may include any template-dependent nucleic acid polymerase having activity of 5' to 3' exonuclease (eg E. coli DNA polymerase I, a thermostable DNA polymerase and bacteriophage T7 DNA polymerase), even more preferably a thermostable DNA polymerase obtained from a variety of bacterial species, including Thermus aquaticus ( Taq), Thermus thermophilus, Thermus filiformis, Thermus flavus, Thermus antranikianii, Thermus caldophilus, Thermus chliarophilus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus species, Thermus spr. Even more preferably, the template-dependent nucleic acid polymerase having 5' to 3' exonuclease activity is Taq DNA polymerase. rase.
[0121] By the enzyme having 5' to 3' exonuclease activity (preferably, the template-dependent nucleic acid polymerase having 5' to 3' exonuclease activity), the TD probe is cleaved and the signal indicative of the target sequence of nucleic acid is generated. The signal can be detected or measured by conventional methods for each tag. For example, the fluorescence signal can be detected or measured by conventional methods, eg fluorometers.
[0122] The term "signal generation" is used in this application to encompass a modification in fluorescent signal strength, including not only increase in fluorescent signal strength but also decrease in fluorescent signal strength. In a preferred embodiment, the signal indicative of the presence of the target nucleic acid sequence to be detected is a signal from the fluorescent reporter molecule. Alternatively, the suppressor molecule is fluorescent and the signal indicative of the presence of the target nucleic acid sequence to be detected is a signal from the fluorescent suppressor molecule.
[0123] When the TD probe is hybridized with the non-target nucleic acid sequence, the second 5' hybridization portion is not digested by the enzyme having 5' to 3' exonuclease activity, resulting in no fluorescence signal.
[0124] The term "no fluorescence signal" refers to no fluorescence signal as well as insignificant fluorescence signal. For example, the term encompasses the usually measured or observed fluorescence intensity for negative control or reference.
[0125] According to a preferred embodiment, the present invention further comprises the repetition of steps (a) - (b) or (a) - (c), and for the repetition of steps (a) - (b) or ( a) - (c), the present invention further comprises denaturation between repeat cycles.
[0126] Methods of denaturation include, but are not limited to, treatment with heat, alkali, formamide, urea, and glycolxal, enzymatic methods (eg, helicase action) and binding proteins. For example, denaturation can be achieved by heating at a temperature ranging from 80°C to 105°C. General methods for performing this treatment are provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001).
[0127] The repetition allows to increase the intensity of the fluorescent signal of the fluorescent reporter molecule. Especially, the repetition in the present method using antisense primers allows to increase the amounts of the target nucleic acid sequence, contributing to increase in intensity of the fluorescence signal of the fluorescent reporter molecule.
[0128] According to a preferred embodiment, the target nucleic acid sequence used is a nucleic acid sequence pre-amplified by an amplification primer.
[0129] The pre-amplified nucleic acid target sequence may include a pre-amplified nucleic acid target sequence in another reaction environment (or reaction vessel) than a reaction environment (or reaction vessel) for the steps (a) - (c).
[0130] Where the present invention further comprises the repetition of steps (a) - (b) or (a) - (c), it is preferred that the signal detection is performed for each cycle of the repetition (i.e., way in time real), at the end of the repetition (i.e., endpoint manner) or at each of predetermined time intervals during the repetition. Preferably, signal detection can be performed for each cycle of the repetition to improve detection accuracy.
[0131] According to a preferred embodiment, the amplification primer (for example, including a sense primer and an antisense primer) for the production of pre-amplified target nucleic acid sequences has a specificity oligonucleotide structure (DSO) represented by the general formula II described above.
[0132] According to a preferred embodiment, the TD probe has a blocking site containing as a blocker at least one nucleotide resistant to cleavage by an enzyme having a 5' to 3' exonuclease activity. According to a preferred embodiment, the blocking site is positioned at a site of the TD probe cleaved by the enzyme having 5' to 3' exonuclease activity and preferably in the 3' hybridization portion of the TD probe.
[0133] When an enzyme having 5' to 3' exonuclease and endonuclease activities (for example, a template-dependent nucleic acid polymerase having 5' to 3' exonuclease and endonuclease activities) is used, for Target Detection more defined, a blocker can be incorporated into the first 3' hybridization portion of a TD probe to block endonuclease catalyzed digestion by the activity of the first 3' hybridization portion of the TD probe hybridized to a non-target nucleic acid sequence.
[0134] According to a preferred embodiment, the TD probe has a blocking site containing as a blocker at least one nucleotide resistant to cleavage by an enzyme having a 5' to 3' exonuclease activity and the blocking site is positioned at a site to be cleaved by the enzyme having 5' to 3' exonuclease activity when the TD probe is hybridized to the non-target nucleic acid sequence; wherein when the TD probe having the blocking site is hybridized to the target nucleic acid sequence, its second 5' hybridization portion is digested by the enzyme having 5' to 3' exonuclease activity to separate the fluorescent reporter molecule from the molecule suppressor in the TD probe, resulting in fluorescence signal generation; wherein when the TD probe having the blocking site is hybridized with the non-target nucleic acid sequence, it is not digested by the enzyme having an exonuclease activity so as not to generate any fluorescence signal.
[0135] According to a preferred embodiment, the blocking site of the TD probe is positioned on the first 3' hybridization portion of the TD probe. More preferably, the blocking site of the TD probe is positioned over the first 3' hybridization portion adjacent to the 3' end of the separation portion.
[0136] According to a preferred embodiment, the blocking site comprises 1 to 15 blockers, more preferably 2 to 10 blockers, even more preferably 3 to 5 blockers.
[0137] Nucleotides that serve as blockers, that is, those that have a skeleton resistant to cleavage by an enzyme having a 5' to 3' exonuclease activity include any known to one of ordinary skill in the art. For example, they include various phosphorothioate linkages, phosphonate linkages, phosphoroamidate linkages, and 2'-carbohydrate modifications. According to a preferred embodiment, nucleotides having a backbone resistant to cleavage by an enzyme having a 5' to 3' exonuclease activity include phosphorothioate linkage, alkyl phosphotriester linkage, aryl phosphotriester linkage, alkyl phosphonate linkage, aryl phosphonate linkage, hydrogen linkage phosphonate, alkyl phosphoroamidate linkage, aryl phosphoroamidate linkage, phosphorouslenate linkage, 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, α-anomeric oligodeoxynucleotide and modification 1-(4'-thio-β-D-ribofuranosyl). The blocking nucleotide present in the TD probe can be one or more continuously or intermittently.
According to a preferred embodiment, the target nucleic acid sequence comprises at least two types (more preferably, at least three types, even more preferably at least five types) of nucleic acid sequences and the TD probe comprises at least at least two types (more preferably, at least three types, even more preferably at least five types) of probes.
[0139] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types (more preferably, at least three types, even more preferably at least five types) of nucleic acid sequences, the TD probe comprises at least at least two types (more preferably at least three types, even more preferably at least five types) of probes and the upstream primer comprises at least two types (more preferably at least three types, even more preferably at least five types) of initiators.
[0140] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types (more preferably, at least three types, even more preferably at least five types) of nucleic acid sequences, the TD probe comprises at least at least two types (more preferably at least three types, even more preferably at least five types) of probes and the antisense primer comprises at least two types (more preferably at least three types, even more preferably at least five types) of initiators.
[0141] In addition, the present invention is very useful in detecting a nucleotide variation. The term "nucleotide variation" used in this application refers to a nucleotide polymorphism in a DNA sequence at a particular position between contiguous DNA segments that are otherwise similar in sequence. Such contiguous DNA segments include a gene or any other portion of a chromosome. For example, the nucleotide variation detected in the present invention includes SNP (single nucleotide polymorphism), deletion, insertion, substitution and translocation. The nucleotide variation exemplified includes numerous variations in a human genome (eg, variations in the MTHFR (methylenetetrahodrofolate reductase) gene, variations involved in drug resistance by pathogens, and variations causing tumorigenesis.
[0142] According to a preferred embodiment, the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second 5' hybridization portion of a TD probe. 2. Target Detection Process in a Solid Phase
[0143] The present invention has excellent adaptability in a solid phase (eg microarray) as well as in a liquid phase.
[0144] In another aspect of this invention, a method is provided for detecting a target nucleic acid sequence in a solid phase of DNA or a mixture of nucleic acids using a distinctive target probe (TD probe), which comprises the steps of: (a) hybridizing the target nucleic acid sequence to the TD probe having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence; wherein the TD probe is immobilized by its 3' end to the surface of the solid substrate; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I)
[0145] wherein, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe has a label which generates a detectable signal and the label is positioned over the second 5' hybridization portion of the TD probe; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased;
[0146] wherein when the TD probe is hybridized with the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion will be hybridized with the target nucleic acid sequence and the second portion of 5' hybridization will be digested by the enzyme having 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand such that the second 5' hybridization portion is not digested by the enzyme having activity a 5' to 3' exonuclease, whereby the TD probe makes it possible to discriminate target nucleic acid sequence from non-target nucleic acid sequence; (b) contacting the resultant of step (a) to the enzyme having 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the target nucleic acid sequence, its second 5' hybridization portion will be digested by the enzyme having 5' to 3' exonuclease activity to release the tag from the TD probe, resulting in a modification of signal on the TD probe immobilized on the solid substrate; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, the second 5' hybridization portion is not digested by the enzyme having 5' to 3' exonuclease activity, resulting in no signal modification, whereby the signal modification on the solid substrate is detected to determine the presence of the target nucleic acid sequence; and (c) detecting the signal modification on the solid substrate, such that the signal modification by digestion at the second 5' hybridization portion is indicative of the presence of the target nucleic acid sequence.
[0147] Since the process of the present invention in the solid phase uses the TD probe and follows the steps of the present method described in the liquid phase, the common descriptions between them are omitted in order to avoid excessive redundancy leading to the complexity of this Description Report.
[0148] For solid phase reaction, the TD probe can be immobilized directly or indirectly (preferably indirectly) by its 3' end to the surface of the solid substrate. Furthermore, probes can be immobilized on the surface of the solid substrate in a covalent or non-covalent manner. Where immobilized probes are immobilized to the solid substrate surface, suitable binders are used. Ligands useful in this invention can include any binder used for probe immobilization to a microarray. For example, alkyl or aryl compounds with amine functionality, or alkyl or aryl compounds with thiol functionality serve as linkers for immobilizing the probe. In addition, poly(T) bases or poly(A) bases can be used as a linker to minimize the spatial hindrance of enzymatic reactions (eg, enzymatic cleavage reactions) or to increase hybridization efficiency. It can be appreciated that poly(T) bases or poly(A) bases are not considered as a sequence that spans the TD probe. For example, poly(T) bases or poly(A) bases attached to the end of the first 3' hybridization portion of the TD probe are not considered to be the first 3' hybridization portion.
[0149] According to a preferred embodiment, the solid substrate used in the present invention is a microarray. The microarray for providing a reaction environment in this invention can include any of those known to one of skill in the art. All processes of the present invention, i.e. annealing for target nucleic acid, extension/digestion and fluorescence detection, are performed in microarray. Microarray immobilized probes serve as hybridizable array elements. The solid substrate for fabricating the microarray includes, but is not limited to, metals (eg, gold, copper and gold alloy, aluminum), metal oxide, glass, ceramic, quartz, silicon, semiconductor, Si/SiO2 wafer, germanium, gallium arsenite, carbon, carbon nanotube, polymers (eg polystyrene, polyethylene, polypropylene and polyacrylamide), sepharose, agarose and colloids. A plurality of probes immobilized in this invention can be immobilized to an addressable region or two or more addressable regions to a solid substrate that can comprise 2 to 1,000,000 addressable regions. Immobilized probes can be fabricated to produce arrays or arrays of a given application by conventional fabrication technologies such as photolithography, inkjet, mechanical microdots, and derivatives thereof.
[0150] According to a preferred embodiment, the enzyme having 5' to 3' exonuclease activity is a thermostable enzyme. According to a preferred embodiment, the enzyme having 5' to 3' exonuclease activity is a template-dependent nucleic acid polymerase, more preferably a thermostable template-dependent nucleic acid polymerase.
[0151] According to a preferred embodiment, step (a) is performed using the TD probe in conjunction with an upstream primer to be hybridized with a site downstream of a hybridized site of the TD probe and the enzyme having exonuclease activity 5' to 3' is a template-dependent nucleic acid polymerase having 5' to 3' exonuclease activity such that the upstream primer is extended by the template-dependent nucleic acid polymerase in step (b).
[0152] According to a preferred embodiment, step (a) is performed using the TD probe in conjunction with an antisense primer and the enzyme having 5' to 3' exonuclease activity is a template-dependent nucleic acid polymerase having 5' to 3' exonuclease activity such that step (b) produces the target nucleic acid sequence hybridizable to the TD probe by a template-dependent nucleic acid polymerase antisense primer extension reaction.
[0153] According to a preferred embodiment, the label is a chemical label, an enzymatic label, a radioactive label, a fluorescent label, an interactive label, a luminescent label, a chemiluminescent label or a metallic label.
[0154] As shown in figure 4 or 5, the present method on solid phase can be performed using a single label (eg a single fluorescent label) or an interactive label (eg a reporter molecule and a suppressor molecule).
[0155] For example, where the TD probe that has a unique fluorescent label is used for the detection of a target nucleic acid sequence, the fluorescent label in the second 5' hybridization portion is released from the TD probe immobilized on the solid substrate, leading to decrease in fluorescence signal intensity on the solid substrate. The reduction or elimination of the fluorescence signal can indicate the presence of the target nucleic acid sequence.
[0156] According to a preferred embodiment, where the unique label is a fluorescent reporter molecule, signal modification is the reduction or elimination of fluorescence signals on the solid substrate.
[0157] According to a preferred embodiment, where the TD probe having a unique fluorescent label is used, the washing step is optionally further comprised before detection in step (c). Alternatively, where the TD probe having a unique fluorescent label is used, the washing step is not understood prior to detection in step (c).
[0158] According to a preferred embodiment, the single fluorescent molecule is positioned at a site in the second 5' hybridization portion to be digested by the enzyme having 5' to 3' exonuclease activity.
[0159] For clarity, it should be appreciated that the phrase "a site in the second 5' hybridization portion to be digested by the enzyme having 5' to 3' exonuclease activity" means that all, a part or a position of the second portion of 5' hybridization can be digested by the enzyme having 5' to 3' exonuclease activity and the label can be positioned anywhere to be digested in the second 5' hybridization portion. Therefore, the phrase "a site in the second 5' hybridization portion to be digested by the enzyme having 5' to 3' exonuclease activity" can be written as "a site to be digested by the enzyme having 5' to 3' exonuclease activity ', in the second 5'" hybridization portion.
[0160] More preferably, the single fluorescent molecule is positioned anywhere in a sequence comprising 1 to 10 5' end nucleotides, even more preferably any site in a sequence comprising 1 to 5 5' end nucleotides, even more preferably, any site of a sequence comprising 1 to 3 nucleotides from the 5' end of the TD probe. Even more preferably, the single fluorescent molecule is positioned over the 5' end of the TD probe.
[0161] According to a preferred embodiment, labeling is the interactive labeling system comprising a pair of a fluorescent reporter molecule and a suppressor molecule.
[0162] According to a preferred embodiment, one of the reporter molecule and the suppressor molecule are positioned at a site in the second 5' hybridization portion of a TD probe and another at a site not to be digested by the enzyme having exonuclease 5 activity. 'to 3'.
[0163] According to a preferred embodiment, one of the reporter molecule and the suppressor molecule are positioned at a site to be digested by the enzyme having 5' to 3' exonuclease activity, in the second 5' hybridization portion of the TD probe and the other at a site not to be digested by the enzyme having 5' to 3' exonuclease activity.
[0164] According to a preferred embodiment, the site not to be digested by the enzyme having 5' to 3' exonuclease activity may exist in the second 5' hybridization portion, separation portion or first 3' hybridization portion of a probe TD
[0165] According to a preferred embodiment, where the present method is performed on the solid phase, the TD probe is immobilized by its 3' end on the surface of a solid substrate; wherein the suppressor molecule is positioned at a site on the second 5' hybridization portion of the TD probe to be digested by the enzyme having 5' to 3' exonuclease activity and the fluorescent reporter molecule is positioned at a site not to be digested by the enzyme having 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the target nucleic acid sequence, its second 5' hybridization portion will be digested by the enzyme having 5' to 3' exonuclease activity to separate the fluorescent reporter molecule from the suppressor molecule in the TD probe, resulting in generation of the reporter molecule fluorescence signal; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, the second 5' hybridization portion is not digested by the enzyme having 5' to 3' exonuclease activity, resulting in no fluorescence signal, whereby the Fluorescent signal on the solid substrate is detected to determine the presence of the target nucleic acid sequence.
[0166] Where the immobilized TD probe is hybridized to the target nucleic acid sequence, it is digested by an enzyme having a 5' to 3' exonuclease activity from the 5' end towards the 3' end. At this time, the binding between an immobilized TD probe fragment and the target nucleic acid becomes weaker, thereby resulting in the release of the target nucleic acid from the immobilized TD probe fragment on the solid substrate. In this sense, it can be considered that the immobilized TD probe has two portions, a portion digested and a portion not digested by the enzyme having a 5' to 3' exonuclease activity. Therefore, the label positioned on the undigested portion of the probe remains on the surface of the solid substrate.
[0167] Considering the immobilized TD probe digestion models, it can be understood that the TD probe can also have a digested portion and an undigested portion within the second 5' hybridization portion. The formation of the digested portion and undigested portion within the TD probe can be affected by the separation portion.
[0168] According to a preferred embodiment, when a blocker, such as modified nucleotides or scaffolds resistant to 5' to 3' exonuclease activity is incorporated into a TD probe site between a suppressor molecule and a reporter molecule, the enzyme having 5' to 3' exonuclease activity is not capable of further digestion of the TD probe due to the presence of the blocker such that the unique label containing the TD probe fragment immobilized as an indigestible portion remains on the solid substrate.
[0169] According to a preferred embodiment, the suppressor molecule is positioned on the second 5' hybridization portion to be digested by the enzyme having 5' to 3' exonuclease activity.
[0170] According to a preferred embodiment, the fluorescent reporter molecule is positioned on the second 5' hybridization portion not to be digested by the enzyme having 5' to 3' exonuclease activity.
[0171] According to a preferred embodiment, the fluorescent reporter molecule is positioned on the first 3' hybridization portion not to be digested by the enzyme having 5' to 3' exonuclease activity.
[0172] According to a preferred embodiment, the fluorescent reporter molecule positioned in a site not to be digested by the enzyme having 5' to 3' exonuclease activity remains on the surface of the solid substrate after step (b), which allows to conveniently detect the fluorescence signal from the reporter molecule in a real-time manner without washing steps.
[0173] Preferably, the suppressor molecule is positioned at the 5' end of the TD probe or 1-3 nucleotides apart from the 5' end and the fluorescent reporter molecule is positioned over the adjacent 3' end of the TD probe or in the middle of the first portion of 3' hybridization of the TD probe.
[0174] According to a preferred embodiment, the suppressor molecule is positioned anywhere in a sequence comprising 1 to 10 5'-end nucleotides, even more preferably, any site in a sequence comprising 1 to 5 5'-end nucleotides, even more preferably, any site of a sequence comprising 1 to 3 nucleotides from the 5' end of the TD probe. Even more preferably, the suppressor molecule is positioned over the 5' end of the TD probe.
[0175] According to a preferred embodiment, the reporter molecule is positioned anywhere in a sequence comprising 1 to 30 3'-end nucleotides, even more preferably, any site in a sequence comprising 1 to 20 3'-end nucleotides, even more preferably, any site of a sequence comprising 1 to 15 nucleotides from the 3' end of the TD probe.
[0176] According to a preferred embodiment, the upstream primer and/or the antisense primer have a dual specificity oligonucleotide (DSO) structure represented by the general formula II described above.
[0177] According to a preferred embodiment, the present invention further comprises the repetition of steps (a) - (b) or (a) - (c) and for the repetition of steps (a) - (b) or (a ) - (c), the present invention further comprises denaturation between repeat cycles.
[0178] Where the present invention further comprises the repetition of steps (a) - (b) or (a) - (c), it is preferred that the signal detection is performed at each repetition cycle (i.e., in real time ), at the end of the repetition (i.e., at a period) or at each of the predetermined time intervals during the repetition. Preferably, signal detection can be performed for each cycle of the repeat to improve detection accuracy and further quantify target nucleic acid.
[0179] According to a preferred embodiment, the target nucleic acid sequence used is a nucleic acid sequence pre-amplified by an amplification primer.
[0180] According to a preferred embodiment, the amplification primer (e.g. including a sense primer and a antisense primer) for the production of pre-amplified target nucleic acid sequences has a specificity oligonucleotide structure (DSO) represented by the general formula II described above.
[0181] According to a preferred embodiment, steps (a) and (b) are carried out simultaneously with the amplification of the target nucleic acid sequence to detect the target nucleic acid sequence in a real-time manner.
[0182] According to a preferred embodiment, the TD probe has a blocking site containing as a blocker at least one nucleotide resistant to cleavage by an enzyme having a 5' to 3' exonuclease activity. According to a preferred embodiment, the blocking site is positioned at a site of the TD probe cleaved by the enzyme having 5' to 3' exonuclease activity and preferably in the 3' hybridization portion of the TD probe.
[0183] According to another preferred embodiment, the TD probe has a blocking site containing as a blocker at least one nucleotide resistant to a 5' to 3' exonuclease activity of an enzyme (for example, the nucleic acid-dependent polymerase template having 5' to 3' exonuclease activity) and the blocking site is positioned at a site cleaved by the endonuclease activity of the enzyme when the TD probe is hybridized to the non-target nucleic acid sequence.
[0184] According to a preferred embodiment, the blocking site of the TD probe is positioned on the first 3' hybridization portion of the TD probe. More preferably, the blocking site of the TD probe is positioned over the first 3' hybridization portion adjacent to the 3' end of the separation portion.
[0185] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types (more preferably, at least three types, even more preferably at least five types) of nucleic acid sequences and the TD probe comprises at least at least two types (more preferably, at least three types, even more preferably at least five types) of probes.
[0186] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types (more preferably, at least three types, even more preferably at least five types) of nucleic acid sequences, the TD probe comprises at least at least two types (more preferably at least three types, even more preferably at least five types) of probes and the upstream primer comprises at least two types (more preferably at least three types, even more preferably at least five types) of initiators.
[0187] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types (more preferably, at least three types, even more preferably at least five types) of nucleic acid sequences, the TD probe comprises at least at least two types (more preferably at least three types, even more preferably at least five types) of probes and the antisense primer comprises at least two types (more preferably at least three types, even more preferably at least five types) of initiators.
[0188] In addition, the present invention is very useful in detecting a nucleotide variation.
[0189] According to a preferred embodiment, the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second 5' hybridization portion of a TD probe. II. Preferred Mode: Real-Time PCR Assay Using the TD Probe
[0190] Preferably, the present invention is carried out simultaneously with the amplification of the target sequence of nucleic acids using a pair of primers composed of two primers as a sense primer and an antisense primer capable of amplifying the target sequence of nucleic acids. Preferably, the amplification is carried out as per PCR (polymerase chain reaction) which is disclosed in U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159.
[0191] In yet another aspect of this invention, a method for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe) and a polymerase chain reaction (PCR) is provided. ), which comprises the steps of: (a) preparing a PCR mixture containing (i) the target nucleic acid sequence, (ii) the TD probe having a hybridization nucleotide sequence complementary to the target nucleic acid sequence, (iii) a pair of primers composed of two primers such as a sense primer and an antisense primer each having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence, and (iv) a dependent nucleic acid polymerase from a template having a 5' to 3' exonuclease activity; wherein the TD probe is hybridized to a site between the two primers; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I)
[0192] wherein, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe is double labeled with a fluorescent reporter molecule and a quencher molecule capable of quenching the reporter molecule's fluorescence; the fluorescent reporter molecule and the quencher molecule are all positioned over the second 5' hybridization portion, or the reporter molecule and the quencher molecule are each positioned over each different portion of the second 5' hybridization portion and the separation portion; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; The Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased;
[0193] wherein when the TD probe is hybridized with the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion will be hybridized with the target nucleic acid sequence and the second portion 5' hybridization will be digested by the 5' to 3' exonuclease activity of the template-dependent nucleic acid polymerase; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand such that the second 5' hybridization portion is not digested by the exonuclease activity 5' to 3' of the template-dependent nucleic acid polymerase, whereby the TD probe makes it possible to discriminate target nucleic acid sequence from non-target nucleic acid sequence; (b) amplification of the target nucleic acid sequence using PCR mixing by performing at least two cycles of primer annealing, extension and primer denaturation, wherein the two primers are extended by an acid polymerase polymerase activity template-dependent nucleic to amplify target nucleic acid sequence; wherein when the TD probe is hybridized to the target nucleic acid sequence, the second 5' hybridization moiety is digested by the 5' to 3' exonuclease activity of the template-dependent nucleic acid polymerase to separate the fluorescent reporter molecule from the suppressor molecule on the TD probe, resulting in generation of a fluorescence signal; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, the second 5' hybridization moiety is not digested by the 5' to 3' exonuclease activity of the template-dependent nucleic acid polymerase such that the fluorescent reporter molecule is not separated from the suppressor molecule on the TD probe, resulting in no fluorescence signal; and (c) detecting the fluorescence signal such that the fluorescence signal generated is indicative of the presence of the target nucleic acid sequence.
[0194] Since the real-time PCR assay of the present invention uses the TD probe and follows the steps of the present method described above, the common descriptions between them are omitted in order to avoid excessive redundancy leading to the complexity of this Descriptive Report.
[0195] In a real-time PCR assay using 5' to 3' nucleolytic reactions, template-dependent nucleic acid polymerases having a 5' to 3' exonuclease activity are employed for target amplification as well as signal generation (by example, TaqMan probe method). As described further above, template-dependent nucleic acid polymerase can have two nucleolytic activities including 5' to 3' exonuclease activity and endonuclease activity. Endonuclease activity can cause the generation of false-positive signals in processes accompanied by target amplification.
[0196] To completely overcome problems and annoyance associated with endonuclease activity, the present invention adopts a unique strategy in which all dual tags are positioned on the second 5' hybridization portion of the TD probe.
[0197] According to a preferred embodiment, the fluorescent reporter molecule and the suppressor molecule are all positioned on the second 5' hybridization portion of the TD probe or the fluorescent reporter molecule and the suppressor molecule each is positioned on each different portion of the second 5' hybridization portion and the separation portion of the TD probe in the real-time PCR reaction.
[0198] Even though the endonuclease activity of the template-dependent nucleic acid polymerase can act on the bifurcation site formed in the first 3' hybridization portion when the TD probe is hybridized with non-target nucleic acid sequences during real-time PCR , the fluorescent reporter molecule and the suppressor molecule positioned on the second 5' hybridization moiety are not separated from each other, such that a fluorescent signal from the fluorescent reporter molecule is not generated by the endonuclease activity.
[0199] In this sense, the real-time PCR assay of the present invention completely ensures the elimination of any possibility of false signal generation.
[0200] According to a preferred embodiment, signal detection is performed for each cycle of the repetition (i.e., real-time manner), at the end of the repetition (i.e., endpoint manner) or at each of predetermined time intervals during repetition. Preferably, signal detection can be performed for each cycle of the repetition to improve detection accuracy.
[0201] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types (more preferably, at least three types, even more preferably at least five types) of nucleic acid sequences, the TD probe comprises at least at least two types (more preferably at least three types, even more preferably at least five types) of probes, the sense primer comprises at least two types (more preferably at least three types, even more preferably at least five types) of primers and the antisense primer comprises at least two types (more preferably, at least three types, even more preferably at least five types) of primers.
[0202] According to a preferred embodiment, the target nucleic acid sequence comprises a nucleotide variation.
[0203] According to a preferred embodiment, the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second 5' hybridization portion of a TD probe.
[0204] According to a preferred embodiment, the sense primer and/or the antisense primer has a dual specificity oligonucleotide (DSO) structure represented by the general formula II described above. III. Target Detection Process by Binding Reaction in a Liquid Phase or in a Solid Phase
[0205] In the further aspect of this invention, there is provided a method for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe), comprising the steps of: (a) hybridizing the target nucleic acid sequence with a first probe having a hybridizing nucleotide sequence complementary to a first site of the target nucleic acid sequence and a second probe having a hybridizing nucleotide sequence complementary to a second site of the target sequence of nucleic acids that are positioned upstream of the first site; wherein at least one of the first probe and the second probe have a label to generate a detectable signal; wherein the second probe is a TD probe; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I)
[0206] wherein, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased; wherein when the second probe is hybridized to the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion of the second probe will be hybridized to the target nucleic acid sequence to allow binding the first probe and the second probe; wherein when the second probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion of the second probe will form a single strand such that the first probe and second probe are not linked, whereby the second probe makes it possible to discriminate target nucleic acid sequence from non-target nucleic acid sequence; (b) binding the first probe and the second probe hybridized to the target nucleic acid sequence such that a bound probe is produced; (c) denaturation of the resultant from step (b); (d) detecting the tag signal on the bound probe such that the signal is indicative of the presence of the target nucleic acid sequence.
[0207] Since the present method using binding reactions employs the TD probe, common descriptions are omitted in order to avoid excessive redundancy leading to the complexity of this Descriptive Report.
[0208] The present method can be performed in a liquid phase or in a solid phase. Preferably, the present method is carried out on a solid phase.
[0209] In the present method using the binding reactions, the first probe and the second probe are first hybridized to the target nucleic acid sequence. The second probe is the TD probe described above. The first probe has a hybridization nucleotide sequence complementary to the first site of the target nucleic acid sequence and the second probe has a hybridization nucleotide sequence complementary to a second site of the target nucleic acid sequence that is positioned upstream of the first site . The first probe and the second probe must be hybridized to the target nucleic acid sequence in the order described above. Unless the hybridization positions of the first probe and the second probe are fulfilled as mentioned above, Target-Specific Detection by the present invention is not performed.
[0210] According to a preferred embodiment, the first probe and the second probe are positioned in positions immediately adjacent to each other when hybridized with the target nucleic acid sequence.
[0211] Adjacent positioning is required for bonding reactions between the two probes. The term "adjacent" used in this application in conjunction with hybridizing positions of the first probe and the second probe means that the 3' end of one probe and the 5' end of another probe are close enough together to allow connection of the ends of both probes to each other.
[0212] According to a preferred embodiment, the 3' end of the first probe has a hydroxyl group and the 5' end of the second probe has a phosphate group.
[0213] The term "immediately adjacent" used in this application in conjunction with hybridization positions of the first probe and the second probe means that it refers to sufficient proximity between two probes to allow the 5' end of the second probe to be brought into juxtaposition with the 3' end of the first probe so that they can be bound by a suitable agent such as ligase. Where the 5' end of the second probe is the 0 nucleotide in addition to the 3' end of the first probe, both probes generate a gap to be ligated together.
[0214] The first probe or the second probe has a tag to generate a detectable signal. Alternatively, both the first probe and the second probe are labeled.
[0215] According to a preferred embodiment, the label is a chemical label, an enzymatic label, a radioactive label, a fluorescent label, an interactive label, a luminescent label, a chemiluminescent label or a metallic label.
[0216] Most preferably, tagging is the interactive tagging system comprising a pair of a reporter molecule and a suppressor molecule. For example, the first probe is labeled with the reporter molecule or suppressor molecule and the second probe is labeled with the suppressor molecule or reporter molecule.
[0217] According to a preferred embodiment, the first probe has a dual specific oligonucleotide (DSO) structure represented by the general formula II described above.
[0218] More preferably, the first probe has the structure of DSO and the second probe is the TD probe and the 3' end of the first probe is positioned immediately adjacent to the 5' end of the second probe.
[0219] Accuracy in detecting target sequences using probes generally depends on the specificity of probes to target sequences. Where the first probe having the structure of DS0 and the second probe having the structure of mDSO (TD probe) is used, the second 3' hybridization portion of the first probe and the second 5' hybridization portion of the second probe are positioned immediately adjacent each other when the two probes are hybridized to the target nucleic acid sequence. Then, the second 3' hybridization portion of the first probe and the second 5' hybridization portion of the second probe are ligated. When the first probe and second probe are hybridized to the non-target sequence, only their first hybridization portions are involved in non-specific hybridization but their second hybridization portions each form a single strand, resulting in no binding of the first probe and of the second probe (figure 6).
[0220] As described above, it can be understood that the pair of probes of the first probe having the structure of DSO and the second probe having the structure of mDSO is completely free of false positive results in Target Detection.
[0221] After hybridization, the first probe and the second probe hybridized with the target nucleic acid sequence are ligated.
[0222] Since enzymatic binding is the preferred method of covalently binding the first probe and the second probe, the term "binding" will be used throughout the patent application. However, the term "binding" is a general term and is to be understood to include any method of covalently binding both probes. An alternative to enzymatic binding is photobinding as described in EP 0324616.
[0223] Bonding in the present invention can be performed according to both alternative methods: First, bonding can be performed by a gap-filling bonding method (U.S. Patent No. 6,004,826). The 3' end of a DNA polymerase extended probe is ligated to the 5' end of another probe. Second, bonding can be performed by a gap-sealing method without extension reactions.
[0224] According to a preferred embodiment, binding in the present invention is performed by sealing the gap without further extension reactions to join the 3' end of one probe to the 5' end of another probe.
[0225] Binding reactions can be carried out using a wide variety of binding agents, including enzymatic binding agents and non-enzymatic binding agents such as chemical and photobinding agents. Chemical coupling agents include, without limitation, activating, condensing and reducing agents, such as carbodiimide, cyanogen bromide (BrCN), N-cyanoimidazole, imidazole, 1-methylimidazole/carbodiimide/cystamine, dithiothreitol (DTT) and ultraviolet light. Self-binding, that is, spontaneous binding in the absence of a binding agent, is also within the scope of the teachings in this application. Detailed protocols of chemical linkage methods and descriptions of appropriate reactive groups can be found in Xu et al., Nucl. Acids Res., 27:875-81 (1999); Gryaznov and Letsinger, Nucl. Acids Res. 21:1403-08 (1993); Gryaznov et al., Nucl. Acids Res. 22:2366-69 (1994); Kanaya and Yanagawa, Biochemistry 25:7423-30 (1986); Luebke and Dervan, Nucl. Acids Res. 20:3005-09 (1992); Sievers and von Kiedrowski, Nature 369:221-24 (1994); Liu and Taylor, Nucl. Acids Res. 26:3300-04 (1999); Wang and Kool, Nucl. Acids Res. 22:2326-33 (1994)).
[0226] Photoligation using light of an appropriate wavelength as a binding agent is also within the scope of the teachings. In certain embodiments, photobinding comprises probes comprising nucleotide analogs, including but not limited to, 4-thiothymidine (s4T), 5-vinyluracil and derivatives thereof, or combinations thereof. In certain embodiments, the binding agent comprises: (a) light in the UV-A range (approximately 320 nm to approximately 400 nm), the UV-B range (approximately 290 nm to approximately 320 nm), or combinations thereof , (b) light having a wavelength between approximately 300 nm and approximately 375 nm, (c) light having a wavelength of approximately 360 nm to approximately 370 nm; (d) light with a wavelength of approximately 364 nm to approximately 368 nm, or (e) light with a wavelength of approximately 366 nm. Descriptions of photobinding can be found in, among other places, Fujimoto et al., Nucl. Acid Symp. Ser. 42:39-40 (1999); Fujimoto et al., Nucl. Acids Res. Suppl. 1:185-86 (2001); Fujimoto et al., Nucl. Acids Suppl., 2:155-56 (2002); Liu and Taylor, Nucl. Acids Res. 26:3300-04 (1998).
[0227] According to a preferred embodiment, the ligation reaction is carried out using a ligase, such as bacteriophage T4 ligase, E. coli ligase and thermostable ligase. Most preferably, the ligation reaction is carried out using thermostable ligase including Afu ligase, Taq ligase, Tfl ligase, Mth ligase, Tth ligase, Tth HB8 ligase, AK16D species Thermus ligase, Ape ligase, LigTk ligase, Aae ligase, Rm ligase and Pfu ligase (Housby et al., Nucl. Acids Res. 28:e10 (2000); Tong et al., Nucl. Acids Res. 28:1447-54 (2000); Nakatani et al., Eur, J. Biochem. 269:650-56 (2002); Zirvi et al., Nucl. Acids Res. 27:e40 (1999); Sriskanda et al., Nucl. Acids Res. 11:2221-28 (2000)).
[0228] Internucleotide linkage generated by linkage includes phosphodiester linkage and other linkages. For example, linkage using ligases generally produces phosphodiester linkages. Non-enzymatic linking methods can form other internucleotide linkages. Other internucleotide linkages include, without limitation, covalent bond formation between suitable reactive groups such as between an α-haloacyl group and a phosphothioate group to form a thiophosphorylacetylamino group, a phosphorothioate group and tosylate or iodide to form a 5'-phosphorothioester , and pyrophosphate bonds.
[0229] After a binding reaction, its resultant is then denatured to separate from the target nucleic acid sequence.
[0230] In the present method performed on solid phase, the first probe or the second probe as an immobilized probe is immobilized on the surface of the solid substrate. Another probe such as a mobilized probe is not immobilized.
[0231] More preferably, in the method performed on solid phase, the first probe is immobilized by its 5' end on the surface of a solid substrate and the second probe is not immobilized. Alternatively, in the method carried out on solid phase, the second probe is immobilized by its 3' end on the surface of the solid substrate and the first probe is not immobilized (figure 6).
[0232] Where a single label molecule is used on the solid phase, it is preferably positioned over the mobilized probe (figure 7).
[0233] When the two probes are hybridized with the non-target nucleic acid sequence, they are not linked together and the mobilized probe is separated from the immobilized probe during denaturation such that no signal is generated.
[0234] As such, the denaturation step is one of the controls to specifically detect the target sequence of nucleic acids in the present invention.
[0235] Finally, the tagging signal on a binding of the first probe and the second probe is detected to identify the presence of the target nucleic acid sequence.
[0236] According to a preferred embodiment, the preset solid phase method further comprises, before step (d), washing the resultant from step (c) for removing the mobilized probe not bound with the immobilized probe.
[0237] According to a preferred embodiment, the method further comprises the repetition of steps (a) - (c) or (a) - (d).
[0238] According to a preferred embodiment, the target nucleic acid sequence used in step (a) is a nucleic acid sequence pre-amplified using an amplification primer. Preferably, the amplification primer has the dual hybridization oligonucleotide (DSO) structure represented by the general formula II.
[0239] The pre-amplified nucleic acid target sequence may include a pre-amplified nucleic acid target sequence in another reaction environment (or reaction vessel) than a reaction environment (or reaction vessel) for the steps (a) - (c). Alternatively, the pre-amplified target nucleic acid sequence can be obtained in the same reaction environment (or reaction vessel) as a reaction environment (or reaction vessel) for steps (a) - (c).
[0240] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types (more preferably, at least three types, even more preferably at least five types) of nucleic acid sequences, the first probe comprises at least at least two types (more preferably at least three types, even more preferably at least five types) of probes and the second probe comprises at least two types (more preferably at least three types, even more preferably at least five types) of probes .
[0241] According to a preferred embodiment, the target nucleic acid sequence comprises a nucleotide variation, more preferably a SNP (single nucleotide polymorphism).
[0242] According to a preferred embodiment, the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second 5' hybridization portion of the second probe. IV. Target Detection Process by Fluorescent Signal Modification Depending on Hybridization in a Liquid Phase or in a Solid Phase
[0243] In yet a further aspect of this invention, a method for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe) is provided, comprising the steps of: ( a) hybridizing the target nucleic acid sequence with the TD probe having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I)
[0244] wherein, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe is labeled with a fluorescent reporter molecule on the second 5' hybridization moiety; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased;
[0245] wherein when the TD probe is hybridized with the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion will be hybridized with the target nucleic acid sequence to induce a modification on the fluorescence of the fluorescent reporter molecule; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand so as not to induce modification in the fluorescence of the fluorescent reporter molecule, whereby the TD probe allows to discriminate target nucleic acid sequence from non-target nucleic acid sequence; and (b) fluorescence detection is modified such that the fluorescence modification is indicative of the presence of the target nucleic acid sequence.
[0246] Since the present invention uses the different hybridization models of the second 5' hybridization portion of the TD probe, the common descriptions are omitted in order to avoid excessive redundancy leading to the complexity of this Description Report.
[0247] It has been revealed that a single fluorophore labeled oligonucleotide generates different fluorescence emission in single-stranded and double-stranded states (see U.S. Patent Nos., 7,348,141 and 7,537,886).
[0248] We found that when the TD probe is labeled with a single fluorescent reporter molecule in its second 5' hybridization portion, a different fluorescence intensity was generated depending on the hybridization with target or non-target nucleic acid sequences.
[0249] The modification in fluorescent reporter fluorescence to be detected ultimately includes the reduction in fluorescence as well as the increase in fluorescence. The types of fluorescence at which the modification can be detected include, but are not limited to, fluorescence intensity, fluorescence polarization, fluorescence lifetime, and fluorescence quantum yield. Even more preferably, the fluorescence to be detected is the fluorescence intensity of the fluorescent reporter molecule.
[0250] The modification in the fluorescence of the fluorescent reporter upon hybridization with target sequences is dependent on several factors, such as types and positions of labels, as found in U.S. Patent Nos., 7,348,141 and 7,537,886.
[0251] The fluorescent reporter molecule used in the present invention can be described with reference to the descriptions given above. In a preferred embodiment, the fluorescent reporter molecule is a fluorescein based molecule (eg JOE, TET or FAM), rhodamine based molecule (eg TAMRA or ROX) or BODIPY530/550.
[0252] The fluorescent reporter molecule is positioned on the second 5' hybridization portion that has the greatest potential for discrimination in the TD probe of target and non-target sequences. As demonstrated throughout the patent application, the hybridization behavior of the second 5' hybridization moiety is the most determining factor in target sequences distinguishing from non-target sequences.
[0253] The fluorescent reporter molecule is positioned over the 5' end, 3' end or inner nucleotide of the second 5' hybridization moiety. Most preferably, the fluorescent reporter molecule is positioned over the inner nucleotide.
[0254] According to a preferred embodiment, the fluorescent reporter molecule is linked to the uracil residue.
[0255] According to a preferred embodiment, the fluorescent modification is observed at a predetermined temperature, or over a range of temperatures.
[0256] According to a preferred embodiment, step (a) is performed using the TD probe together with an antisense primer and a template-dependent nucleic acid polymerase such that the target nucleic acid sequence is hybridizable to the TD probe is further generated to increase the fluorescence modification indicative of the presence of the target nucleic acid sequence.
[0257] According to a preferred embodiment, step (a) is performed using the TD probe together with a pair of primers composed of two primers such as a sense primer and an antisense primer and a nucleic acid polymerase template-dependent such that the target nucleic acid sequence hybridizable to the TD probe is amplified by PCR to increase the fluorescence modification indicative of the presence of the target nucleic acid sequence.
[0258] Alternatively, the TD probe is further labeled with a quencher molecule capable of quenching the fluorescence of the reporter molecule and the quencher is positioned over the TD probe to quench the fluorescence of the reporter molecule when the TD probe or the second hybridizing moiety 5 ' of the TD probe are not involved in hybridization to the target nucleic acid sequence.
[0259] According to a preferred embodiment, the quencher is positioned on the TD probe to quench the fluorescence of the reporter molecule conformationally when the TD probe or the second 5' hybridization portion of the TD probe are not involved in hybridization with the sequence- nucleic acid target.
[0260] According to a preferred embodiment, the suppressor molecule is fluorescent and the signal indicative of the presence of the target nucleic acid sequence to be detected is a signal from the fluorescent suppressor molecule.
[0261] Where the present invention is carried out in conjunction with the antisense primer or the pair of primers, the template-dependent nucleic acid polymerase is preferably a thermostable polymerase without 5' to 3' exonuclease activity including the Stoffel fragment from Taq polymerase (FC Lawyer et al., Genome Res. 2:275-287 (1993)) and mutant forms of DNA polymerase of Thermus aquaticus, Thermus flavus or Thermus thermophilus (US Patent No. 5885813). Examples of those are: KOD (exo-) DNA polymerase (TOYOBO), Vent (exo-) DNA polymerase (NEB), Deep Vent (exo-) DNA polymerase (NEB), PlatinumTM Tfi Exo (-) DNA polymerase (Invitrogen), Amplitaq stoffel DNA polymerase fragment (ABI), Exo-Pfu DNA polymerase (Agilent).
[0262] The present method can also be performed using thermostable polymerases with 5' to 3' exonuclease activities.
[0263] According to a preferred embodiment, the present method is performed in a liquid phase or in a solid phase. When the present method is carried out on the solid phase, the TD probe is immobilized by its 3' end on the surface of a solid substrate. V. Design and Preparation of a Probe Capable of Distinctive Target Sequences
[0264] In another aspect of this invention, a method is provided for allowing a probe molecule to discriminate a target nucleic acid sequence from a non-target nucleic acid sequence, comprising the steps of: (a) selecting a sequence target nucleic acids; (b) designing a sequence of a probe molecule having (i) a hybridization sequence complementary to the target nucleic acid and (ii) a separating portion comprising at least three universal bases, such that the separating portion intervenes in the sequence of hybridization to form three moieties on the probe molecule; and (c) determining the position of the separating portion on the probe molecule to allow a portion in the 5' direction of the separating portion to have a lower Tm than a portion in the 3' direction of the separating portion and allowing the portion to separation will have the lowest Tm in the three portions, thereby providing the probe molecule having three distinct portions with different Tm values from each other wherein (i) a second 5' hybridizing portion of the probe molecule has a hybridizing nucleotide sequence complementary to the target nucleic acid, (ii) a first 3' hybridizing portion of the probe molecule has a hybridizing nucleotide sequence complementary to the target nucleic acid; and (iii) the portion separating the probe molecule between the second 5' hybridization portion and the first 3' hybridization portion comprises at least three universal bases; and the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separating portion has the lowest Tm in all three portions,
[0265] wherein when the probe molecule is hybridized with the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion will be hybridized with the target nucleic acid sequence; wherein when the probe molecule is hybridized with the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand, whereby the probe molecule allows to discriminate the target acid sequence non-target nucleic acid sequence nucleic acids.
[0266] The present method is aimed at providing a new approach to dramatically increase the discrimination power of target sequence probes. The present method can also be expressed as a method for improving a probe's discrimination ability to target sequences.
[0267] The present method is performed to prepare the TD probe discussed above. Therefore, in the interest of avoiding unnecessary redundancy, the descriptions common between them are not being repeated but are incorporated into this method description as if they were repeated.
[0268] The present method provides a new strategy to increase discrimination capacity by introducing new features into oligonucleotide sequences per se, which provides new probes to show different hybridization behaviors with target and non-target sequences.
[0269] It is critical in the present method to design a sequence of a probe molecule having (i) a complementary hybridization sequence to the target nucleic acid and (ii) a separation portion comprising at least three universal bases, such that the separation portion intervene in the hybridization sequence to form three moieties on the probe molecule.
[0270] In this step, the structural outline of the oligonucleotide is presented to show a 5' end portion/split portion/3' end portion in the oligonucleotide. Both the 5' end and the 3' end portions carry a complementary hybridization sequence to the target nucleic acid and are separated by the separation portion.
[0271] The most critical step in the present invention is to determine the position of the separating portion on the probe to allow a portion in the 5' direction of the separating portion to have a lower Tm than a portion in the 3' direction of the separating portion and allowing the separating moiety to have the lowest Tm in the three moieties, thereby providing an oligonucleotide having three distinct moieties with different Tm values from each other.
[0272] The new structural features introduced in oligonucleotides by the present method are: (i) three distinct portions (second 5' hybridization portion, separation portion and first 3' hybridization portion) in oligonucleotide sequences; (ii) Tm values different from each other; (iii) separation portion comprising at least three universal bases between the second 5' hybridization portion and the first 3' hybridization portion; (iv) two moieties involved in molecular interaction with targets in hybridization, which is separated in terms of the hybridization event by the separation moiety; (v) Tm values after ordering the first hybridization portion 3', the second hybridization portion 5' and the separation portion. Such structural features ensure probe hybridization occurs in distinctly different ways to target and non-target sequences, allowing for a dramatic increase in the hybridization specificity of probes to their target sequences. IV. Target Sense Sets 1. Target Sense Sets in a Liquid Phase
[0273] In still further aspect of this invention, there is provided a kit for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids, which comprises a distinctive target probe (TD probe) having a specificity oligonucleotide structure Modified dual (mDSO) represented by the general formula I described above to allow discrimination of the target nucleic acid sequence from a non-target nucleic acid sequence.
[0274] Since the set of this invention is built to perform the detection methods of the present invention described above, the common descriptions between them are omitted in order to avoid excessive redundancy leading to the complexity of this Description Report.
[0275] According to a preferred embodiment, the TD probe has a tag or an interactive tagging system containing a plurality of tags to generate a detectable signal.
[0276] Most preferably, the interactive labeling system is a pair of a reporter molecule and a suppressor molecule positioned on the TD probe
[0277] According to a preferred embodiment, the reporter molecule and the suppressor molecule are all positioned on the second 5' hybridization portion or the reporter molecule and the suppressor molecule are each positioned on each different portion of the second hybridization portion 5 ' and the separation portion.
[0278] According to a preferred embodiment, the TD probe has one of the reporter molecule and the suppressor molecule in its second 5' hybridization portion and another in its first 3' hybridization portion.
[0279] According to a preferred embodiment, wherein the set further comprises an enzyme having a 5' to 3' exonuclease activity.
[0280] According to a preferred embodiment, the kit further comprises a template-dependent nucleic acid polymerase having 5' to 3' exonuclease activity and at least one of an upstream primer to be hybridized with a site downstream of a hybridized site of the TD probe and an antisense primer.
[0281] According to a preferred embodiment, the target nucleic acid sequence used is a nucleic acid sequence pre-amplified by an amplification primer and the set further comprises the amplification primer.
[0282] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types of nucleic acid sequences and the TD probe comprises at least two types of probes.
[0283] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types of nucleic acid sequences, the TD probe comprises at least two types of probes and the upstream primer comprises at least two types of primers or the antisense primer comprises at least two types of primers.
[0284] According to a preferred embodiment, the target nucleic acid sequence comprises a nucleotide variation.
[0285] According to a preferred embodiment, the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second 5' hybridization portion of the TD probe.
[0286] According to a preferred embodiment, the TD probe has a blocking site containing as a blocker at least one nucleotide resistant to cleavage by an enzyme having a 5' to 3' exonuclease activity and the blocking site is positioned over the first 3' hybridization portion of the TD probe. 2. Target Detection Sets in a Solid Phase
[0287] In another aspect of this invention, there is provided a kit for detecting a target sequence of nucleic acids in a solid phase of DNA or a mixture of nucleic acids using a distinctive target probe (TD probe), which comprises: (a ) the TD probe having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence; wherein the TD probe is immobilized by its 3' end to the surface of the solid substrate; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I)
[0288] wherein, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe has a label which generates a detectable signal and the label is positioned over the second 5' hybridization portion of the TD probe; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased;
[0289] wherein when the TD probe is hybridized with the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion will be hybridized with the target nucleic acid sequence and the second portion of 5' hybridization will be digested by the enzyme having 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand such that the second 5' hybridization portion is not digested by the enzyme having activity a 5' to 3' exonuclease, whereby the TD probe makes it possible to discriminate target nucleic acid sequence from non-target nucleic acid sequence; and (b) the solid substrate.
[0290] Since the set of this invention is built to perform the detection method of the present invention described above, the common descriptions between them are omitted in order to avoid excessive redundancy that leads to the complexity of this Description Report.
[0291] According to a preferred embodiment, the label is a chemical label, an enzymatic label, a radioactive label, a fluorescent label, an interactive label, a luminescent label, a chemiluminescent label or a metallic label. More preferably, the labeling is the interactive labeling system comprising a pair of a fluorescent reporter molecule and a suppressor molecule and the TD probe has one of the reporter molecule and the suppressor molecule at one site in the second 5' hybridization moiety and another in a site not being digested by the enzyme having 5' to 3' exonuclease activity.
[0292] According to a preferred embodiment, the suppressor molecule is positioned at a site in the second 5' hybridization portion of the TD probe and the fluorescent reporter molecule is positioned at a site not to be digested by the enzyme having 5' exonuclease activity at 3'; wherein when the TD probe is hybridized to the target nucleic acid sequence, its second 5' hybridization portion will be digested by the enzyme having 5' to 3' exonuclease activity to separate the fluorescent reporter molecule from the suppressor molecule in the TD probe, resulting in generation of a fluorescence signal; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, the second 5' hybridization portion is not digested by the enzyme having 5' to 3' exonuclease activity, resulting in no fluorescence signal whereby the signal Fluorescent on the solid substrate is detected to determine the presence of the target nucleic acid sequence.
[0293] According to a preferred embodiment, the set further comprises an enzyme having a 5' to 3' exonuclease activity.
[0294] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types of nucleic acid sequences and the TD probe comprises at least two types of probes.
[0295] According to a preferred embodiment, the target nucleic acid sequence comprises a nucleotide variation and the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second 5' hybridization portion of the probe TD
[0296] According to a preferred embodiment, the TD probe has a blocking site containing as a blocker at least one nucleotide resistant to cleavage by an enzyme having a 5' to 3' exonuclease activity and the blocking site is positioned on the first 3' hybridization portion of the TD probe. 3. Target Detection Sets Using PCR
[0297] In yet another aspect of this invention, a kit is provided for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe) and a polymerase chain reaction (PCR) ), which comprises: (a) the TD probe having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence; and (b) a pair of primers composed of two primers as an upstream primer and a antisense primer each having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence;
[0298] in which the TD probe is hybridized to a site between the two primers; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I)
[0299] wherein, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe is double labeled with a fluorescent reporter molecule and a quencher molecule capable of quenching the reporter molecule's fluorescence; the fluorescent reporter molecule and the quencher molecule are all positioned over the second 5' hybridization portion, or the reporter molecule and the quencher molecule are each positioned over each different portion of the second 5' hybridization portion and the separation portion; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; The Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased;
[0300] wherein when the TD probe is hybridized with the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion will be hybridized with the target nucleic acid sequence and the second portion 5' hybridization will be digested by a 5' to 3' exonuclease activity of a template-dependent nucleic acid polymerase; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand such that the second 5' hybridization portion is not digested by the exonuclease activity 5' to 3' of the template-dependent nucleic acid polymerase, whereby the TD probe makes it possible to discriminate target nucleic acid sequence from non-target nucleic acid sequence.
According to a preferred embodiment, the kit further comprises a template-dependent nucleic acid polymerase having a 5' to 3' exonuclease activity.
[0302] According to a preferred embodiment, the target nucleic acid sequence used is a nucleic acid sequence pre-amplified by an amplification primer and the set further comprises the amplification primer.
[0303] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types of nucleic acid sequences, the TD probe comprises at least two types of probes, the sense primer comprises at least two types of primers and the antisense primer comprises at least two types of primers.
[0304] According to a preferred embodiment, the target nucleic acid sequence comprises a nucleotide variation.
[0305] According to a preferred embodiment, the sense primer, the antisense primer or the amplification primer has a dual specificity oligonucleotide (DSO) structure represented by the general formula II.
[0306] According to a preferred embodiment, the TD probe has a blocking site containing as a blocker at least one nucleotide resistant to cleavage by an enzyme having a 5' to 3' exonuclease activity and the blocking site is positioned in the first portion of 3' hybridization.
[0307] According to a preferred embodiment, the blocking site of the TD probe is positioned on the first 3' hybridization portion of the TD probe. More preferably, the blocking site of the TD probe is positioned adjacent to the 3' end of the separating portion.
[0308] According to a preferred embodiment, the blocking site comprises 1 to 10 blockers. 4. Sets for Target Detection Using Binding Reaction
[0309] In the further aspect of this invention, there is provided a kit for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe) by a binding reaction, comprising: ( a) a first probe having a hybridizing nucleotide sequence complementary to a first site of the target nucleic acid sequence; and (b) a second probe having a hybridizing nucleotide sequence complementary to a second site of the target nucleic acid sequence that is positioned upstream from the first site;
[0310] wherein at least one of the first probe and the second probe has a label to generate a detectable signal; wherein the second probe is a TD probe; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I)
[0311] wherein, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased;
[0312] wherein when the second probe is hybridized with the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion of the second probe will be hybridized with the target nucleic acid sequence for allow the connection of the first probe and the second probe; wherein when the second probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion of the second probe will form a single strand such that the first probe and second probe are not linked, whereby the second probe makes it possible to discriminate the target nucleic acid sequence from the non-target nucleic acid sequence;
[0313] According to a preferred embodiment, the set further comprises a ligase to bind to the first probe and the second probe hybridized with the target nucleic acid sequence.
[0314] According to a preferred embodiment, the label is a chemical label, an enzymatic label, a radioactive label, a fluorescent label, an interactive label, a luminescent label, a chemiluminescent label or a metallic label.
[0315] According to a preferred embodiment, labeling is the interactive labeling system that comprises a pair of a reporter molecule and a suppressor molecule.
[0316] According to a preferred embodiment, the first probe has a dual specific oligonucleotide (DSO) structure represented by the general formula II.
[0317] According to a preferred embodiment, the target nucleic acid sequence used is a nucleic acid sequence pre-amplified using an amplification primer and the set further comprises the amplification primer.
[0318] According to a preferred embodiment, the set is used for a solid phase; wherein the first probe is immobilized by its 5' end to the surface of a solid substrate and the second probe is not immobilized.
[0319] According to a preferred embodiment, the set is used for a solid phase; wherein the second probe is immobilized by its 3' end to the surface of the solid substrate and the first probe is not immobilized.
[0320] According to a preferred embodiment, the first probe and the second probe are positioned in positions immediately adjacent to each other when hybridized with the target nucleic acid sequence.
[0321] According to a preferred embodiment, the target nucleic acid sequence comprises at least two types of nucleic acid sequences and the first probe and the second probe each comprise at least two types of probes.
[0322] According to a preferred embodiment, the target nucleic acid sequence comprises a nucleotide variation.
[0323] According to a preferred embodiment, the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second 5' hybridization portion of the second probe. 5. Hybridization-based Target Detection Sets
[0324] In still further aspect of this invention, there is provided a kit for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe), which comprises:
[0325] a distinctive target probe (TD probe) having a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I to allow discrimination of target nucleic acid sequence from a non-target nucleic acid sequence: '-X'p-Y'q-Z'r-3' (I)
[0326] wherein, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe is labeled with a fluorescent reporter molecule on the second 5' hybridization moiety; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased; wherein when the TD probe is hybridized to the target nucleic acid sequence, both the second 5' hybridization moiety and the first 3' hybridization moiety will hybridize to the target nucleic acid sequence to induce a change in the fluorescence of the fluorescent reporter molecule; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand so as not to induce modification in the fluorescence of the fluorescent reporter molecule, whereby the TD probe allows to discriminate target nucleic acid sequence from non-target nucleic acid sequence.
According to a preferred embodiment, the kit further comprises an antisense primer and a template-dependent nucleic acid polymerase to further generate the target nucleic acid sequence hybridizable with the TD probe to increase the indicative fluorescence modification the presence of the target nucleic acid sequence.
[0328] Preferably, the set further comprises a pair of primers composed of two primers such as a sense primer and an antisense primer and a template-dependent nucleic acid polymerase to amplify the target nucleic acid sequence hybridizable to the PCR TD probe to increase fluorescence modification indicative of the presence of target nucleic acid sequence.
[0329] Alternatively, the TD probe is additionally labeled with a quencher molecule capable of quenching the fluorescence of the reporter molecule, and the quencher is positioned over the TD probe to induce a self-extinction when the TD probe is not involved in hybridization with the sequence- nucleic acid target.
[0330] Where the present set comprises the antisense primer or the pair of primers, the template-dependent nucleic acid polymerase is preferably a thermostable polymerase without 5' to 3' exonuclease activity including Stoffel fragment of Taq polymerase and mutant forms of DNA polymerase from Thermus aquaticus, Thermus flavus or Thermus thermophilus (US Patent No. 5885813).
[0331] The present set is in a liquid phase or in a solid phase.
[0332] All of the present kits described above may optionally include the reagents necessary to perform targeted PCR amplification reactions (eg PCR reactions), such as buffers, DNA polymerase cofactors, and deoxyribonucleotide-5-triphosphates. Optionally, kits can also include various polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. Kits can also include the reagents needed to perform positive and negative control reactions. The optimal amounts of reagents to be used in a given reaction can be readily determined by the expert having the benefit of current disclosure. Assemblies are typically adopted to contain the constituents described above in separate packaging or compartments.
[0333] The features and advantages of this invention will be summarized as follows: (a) The TD probe having the structure of mDSO is hybridized to the target nucleic acid sequence through its entire sequence including the second 5' hybridization portion and the first 3' hybridization portion. Under TD probe target specific hybridization conditions, when the TD probe is hybridized to non-target nucleic acid sequences, its first 3' hybridization moiety does not specifically bind to non-target nucleic acid sequences but both the second hybridization moiety 5 as the separating portion are not hybridized with the non-target nucleic acid sequence to form a single strand due to their low Tm values.
As such, the second 5' hybridization portion of the TD probe exhibits distinctly different hybridization patterns of each of the target and non-target nucleic acid sequences, discriminating the target nucleic acid sequences from the non-target nucleic acid sequences with much higher specificity. (b) Target Detection applications using the TD probe show dramatically increased target specificity due to the following target surveillance events: First, the TD probe having different hybridization patterns of each of the target and non-target acid sequences Nucleic acid as described above is capable of discriminating target nucleic acid sequences from non-target nucleic acid sequences with much higher specificity. Second, the occurrence of successive enzymatic reactions (exonucleolytic reaction or binding) is determined depending on the TD probe hybridization models, raising the target specificity in the Target Detection procedures. (c) The target discrimination capability of the TD probe by different hybridization models is successfully adopted in Target Detection methods using 5' to 3' exonuclease activity, completely preventing the generation of false positive signals (results). For illustration, where a conventional probe having a tag in its 5' end portion is hybridized with non-target sequences in its 5' portion, the 5' portion is digested by 5' to 3' exonuclease activity to generate false positive signals . Unlikely, even when the TD probe hybridizes to non-target sequences, its second 5' hybridization portion will not hybridize to non-target sequences not to generate any false positive signal. (d) In the real-time PCR method for detection of target nucleic acid sequences, the TD probe with the reporter molecule and the suppressor molecule all positioned on the second 5' hybridization portion or each positioned on the second portion of 5' hybridization and the separation portion are shown to excellently prevent the occurrence of false signals. Conventional technologies such as the TaqMan™ probe method are suffering from false positive signals due to non-specific binding of labeled probes, particularly in multiple target detection. However, the present invention successfully overcomes such problems by using the TD probe having the reporter molecule and the suppressor molecule all positioned over the second 5' hybridization moiety. Furthermore, the peculiarly dual-labeled TD probe as described above allows for overcoming gaps associated with the 5' to 3' endonuclease activity of polymerases which becomes problematic depending on the types of polymerases and reaction conditions. (e) The TD probe's unique hybridization model also allows excellently preventing false positive signals in Target Detection processes using binding activity. Generally, Target Detection methods using the ligation of two probes (a first probe upstream and a second probe downstream) demand double stranded (duplex) forms of adjacent end portions of the two probes in the ligation. In the present binding assay using the TD probe as a second probe, the second 5' hybridization portion of the TD probe forms a single strand shape when the TD probe is hybridized to non-target sequences, and therefore prevents non-target binding reactions. generate no false positive signal. (f) The TD probe shows excellent specificity for discriminating single nucleotide variation using the hybridization templates other than the second 5' hybridization moiety. Even if a single mismatched nucleotide is present between the second 5' hybridization portion of the TD probe and a nucleic acid sequence, the TD probe is able to recognize the sequence as a non-target sequence and its second 5' hybridization portion forms a single tape that does not result in any false positive signals. Specifically, the TD probe has plausible resolving power in detecting SNP. (g) The TD probe allows you to personify microarray systems for accurate, high-throughput solid-phase assay. Conventional microarray systems using conventional probes are suffering from false positive signals due to non-specific hybridization of conventional probes. In contrast, the present solid phase assay using the TD probe in conjunction with 5' to 3' exonuclease activity (or binding activity) allows detection of target nucleic acid sequences in a real-time manner as well as sequence detection target nucleic acids more accurately and quickly.
[0335] The present invention will now be described in further detail by the examples. It would be obvious to those skilled in the art that these examples are intended to be more concretely illustrative and the scope of the present invention as set out in the appended claims is not limited to or by the examples. EXAMPLES EXAMPLE 1: Evaluation of cleavage activity of an enzyme having a 5' to 3' exonuclease activity on the 5' end mismatched probe
[0336] It is examined whether an enzyme having a 5' to 3' exonuclease activity can cleave a probe having mismatched nucleotides in its 5' end portion.
[0337] To examine this evaluation, the synthetic oligonucleotide gene from Staphylococcus aureus (SA) was used as a template. Five different types of dual-labelled probes have been used and have a compatible sequence, single mismatched nucleotide, three mismatched nucleotides, six mismatched nucleotides and nine mismatched nucleotides at their 5' end portions, respectively. The dual-labelled probe has 6-FAM (6-carboxyfluorescein) as a fluorescent reporter molecule at its 5' end and Black Hole Suppressor 1 (BHQ-1) as a suppressor molecule at its 3' end portion. The dual-labelled probe is modified by the C3 spacer at its 3' end such that the dual-labelled probe is not extended.
[0338] A DNA polymerase having a 5' to 3' exonuclease activity was used for 5' to 3' exonucleolytic reactions with dual-labelled probes and the template (S. aureus gene). Signals were measured at the hybridization step of each cycle.
[0339] The synthetic template sequences and dual-labeled probes of the S. aureus gene used in this Example are: SA_T70 5'-GGTGTAGGTGGTGGCGGTAACAACG CCGTAAACCGAATGATTGACCACGGAATGA ATAATGTTG AATTTA-3' (SEQ ID NO:1) SA_P0 5'-[FAM]CATTC T(BHQ-1)]TACGGCGTTGTTACC[C3 spacer]-3' (SEQ ID NO:2) SA_P1 5'-[FAM]CCATTCGGT[T(BHQ-1)]TACGGCGTTGTTACC[C3 spacer]-3' (SEQ ID NO :3) SA_P3 5'-[FAM]TGCCATTCGGT[T(BHQ-1)]TACGGCGTTGTTACC[C3 spacer]-3' (SEQ ID NO:4) SA_P6 5'-[FAM]ACTTGCCATTCGGT[T(BHQ-1)] TACGGCGTTGTTACC[C3 spacer]-3' (SEQ ID NO:5) SA_P9 5'-[FAM]ACAACTTGCCATTCGGT[T(BHQ-1)]TACGGCGTTGTTACC [C3 spacer]-3' (SEQ ID NO:6) (Underlined letters and in bold indicate the incompatible nucleotides.)
[0340] The exonucleolytic reaction was conducted in the final volume of 20 μl containing 0.2 pmols of the synthetic oligonucleotide from S. aureus (SEQ ID NO: 1), 5 pmols of the dual-labeled probe (SEQ ID NO: 2, 3, 4 , 5 or 6), and 10 µl 2X Master Mix containing 6 mM MgCl 2 , 200 µM dNTPs, and 2 units DiaStarTMTaq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the real-time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 2 min at 95°C and subjected to 40 cycles of 20 seconds at 95°C, and for 60 seconds at 60°C. The detection of the generated signal was carried out in the hybridization step (60°C) of each cycle.
[0341] As shown in figure 8, when dual-labeled probes having the matched sequence and single mismatched nucleotide at their 5' end portions were used, fluorescent signals for SA were generated (numbers 1 and 3). On the other hand, no fluorescent signal for SA was observed in the case of using the dual-labelled probes having at least three mismatched nucleotides at their 5' end portions (numbers 5, 7 and 9). There was no signal in the absence of the mold as a negative control (number 2, 4, 6, 8 and 10).
[0342] These results indicate that the enzyme having 5' to 3' exonuclease activity dose does not cleave the probe having at least three mismatched nucleotides in its 5' end portion. EXAMPLE 2: Evaluation of a dual-labeled TD probe for discrimination of a target nucleic acid sequence and a non-target nucleic acid sequence using an enzyme having a 5' to 3' exonuclease activity.
[0343] The TD probe of this invention was evaluated whether a dual-labeled TD probe can discriminate a target nucleic acid sequence from a non-target nucleic acid sequence using an enzyme having a 5' to 3' exonuclease activity.
[0344] First, we demonstrate whether target-specific signal can be generated by hybridization models other than the TD probe in its second 5' hybridization portion.
[0345] To examine this evaluation, synthetic oligonucleotides from the genes of Staphylococcus aureus (SA) and Neisseria gonorrhoeae (NG) were used as templates. Two different types of TD probes from each gene have a compatible sequence and a mismatched sequence in their second 5' hybridization portions, respectively. The dual-labeled TD probe has 6-FAM (6-carboxyfluorescein) as a fluorescent reporter molecule at its 5' end and Black Hole Suppressor 1 (BHQ-1) as a suppressor molecule at its first 3' hybridization moiety. The dual-labeled TD probe is modified by the C3 spacer at its 3' end such that the dual-labeled TD probe is not extended.
[0346] A DNA polymerase having a 5' to 3' exonuclease activity was used for 5' to 3' exonucleolytic reactions with the dual-labeled TD probe and the target template (S. aureus or N. gonorrhoeae gene). Signals were measured at the hybridization step of each cycle. A. Target-specific signal generation of S. aureus gene using a TD probe
[0347] The synthetic template sequences and the dual-labeled TD probes of the S. aureus gene used in this Example are: SA_T70 5'-GGTGTAGGTGGTGGCGGTAACAACGCCGTAAACCGA ATGATTGACCACGGAATGAATAATGTTG AATTTA-3' (SEQ ID NO:1) SA_TD_M 5'-[6] CATTCCGTGGIIIIICATTCGGTT[T(BHQ- 1)]ACGGCG TTGTTACC[spacer C3]-3' (SEQ ID NO:7) SA_TD_m 5'-[6-FAM]TGCCTTATAAIIIIICATTCGGTT[T(BHQ-1)]ACGGCG-TTGTTACC [spacer C3] -3' (SEQ ID NO:8)
[0348] The exonucleolytic reaction was conducted in the final volume of 20 μl containing 0.2 pmols of the synthetic oligonucleotide from S. aureus (SEQ ID NO: 1), 5 pmols of the dual-labeled TD probe (SEQ ID NO: 7 or 8) , and 10 µl 2X Master Mix containing 6 mM MgCl 2 , 200 µM dNTPs, and 2 units DiaStarTMTaq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the real-time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 2 min at 95°C and subjected to 40 cycles of 20 seconds at 95°C, and for 60 seconds at 60°C. The detection of the generated signal was carried out in the hybridization step (60°C) of each cycle.
[0349] As shown in Fig. 9A, the fluorescent signal from the SA nucleic acid target sequence was generated, when the dual-labeled TD probe having the matched sequence in its second 5' hybridization portion was used (No. 1). On the other hand, no fluorescent signal from the SA nucleic acid target sequence was observed in case of using the dual-labeled TD probe which has the incompatible sequence in its second 5' hybridization portion (No. 3). There was no sign of the absence of the mold as a negative control (Nos. 2 and 4). B. Target-specific signal generation of the N. gonorrhoeae gene using a TD probe
[0350] The synthetic template sequences and the dual-labeled TD probes of the N. gonorrhoeae gene used in this Example are: NG_T100 5'-GAAATTATGCCCTTAAATATGCGAAACACGCCAATGAGGG GCATGATGCTTTCTTTTTTGTT CTTGCTCGGCAGCGAGTGATACCGATCCATTGAAAAA-3'; NG_TD_M 5'-[6-FAM]AGCATCATGCIIIIIIATTGGCGTG[T(BHQ-1)]TTCGCAT ATTTAAG [C3 spacer]-3' (SEQ ID NO:10); NG_TD_m 5'-[6-FAM]GATGCTGTATIIIIIATTGGCGTG[T(BHQ-1)] TTCGCATATTTAAG[spacer C3]-3' (SEQ ID NO:11); (Underlined and bold letters indicate incompatible nucleotides.)
[0351] The exonucleolytic reaction was conducted as the same protocol used for S. aureus, except the template (2 pmols of N. gonorrhoeae) and the dual-labeled TD probes (SEQ ID NO: 10 or 11).
[0352] As shown in figure 9B, the fluorescent signal from the NG nucleic acid target sequence was generated, when the dual-labeled TD probe having the matched sequence in its second 5' hybridization portion was used (No. 1). On the other hand, no fluorescent signal from the NG nucleic acid target sequence was observed in the case of using the dual-labeled TD probe having the mismatched sequence in its second 5' hybridization portion (No. 3). There was no signal in the absence of the mold as a negative control (Nos. 2 and 4).
[0353] These results showed the generation of target signal from the TD probe depending on the hybridization of its second 5' hybridization portion, indicating that the TD probe can discriminate a target nucleic acid sequence from a non-target nucleic acid sequence. EXAMPLE 3: Effect of 5' end portions between the TD probe and the conventional probe
[0354] It is examined whether the 5' end portion of a conventional probe has the same effect as the second 5' hybridization portion of a TD probe.
[0355] For this exam, we used two different types of TD probes; one TD probe has a matching sequence in its second 5' hybridization portion and the other has three mismatched nucleotides in its second 5' hybridization portion. Conventional probes have the same sequences as TD probes except deoxynosine.
[0356] Synthetic oligonucleotide from Staphylococcus aureus (SA) was used as a template. The conventional probe and TD each have 6-FAM (6-carboxyfluorescein) as a fluorescent reporter molecule at its 5' end and Black Hole Suppressor 1 (BHQ-1) as a suppressor molecule at its 3' portion. All probes are modified by the C3 spacer at their 3' ends.
[0357] A DNA polymerase having a 5' to 3' exonuclease activity was used for 5' to 3' exonucleolytic reactions with the dual-labeled TD probe and the target template (S. aureus).
[0358] The synthetic and conventional dual-labeled template sequences and S. aureus gene TD probes used in this Example are: SA_T70 5'-GGTGTAGGTGGTGGCGGTAACAACGCCGTAAA CCGAATGATTGACCACGGAATGAATAATGTTG AATTTA-3' (SEQ ID NO:1) SA_TD_M 5'-[6 ]CATTCCGTGGIIIIICATTCGGTT[T(BHQ- 1)]ACGGCGT TG TTACC[spacer C3]-3' (SEQ ID NO:7) SA_TD_m1 5'-[6-FAM]CACCTCGTGGIIIIICATTCGGTT[T(BHQ1)]ACGGCGTTGTTACC[spacer C3] ' (SEQ ID NO:12) SA_Con_M 5'-[6-FAM]CATTCCGTGGTCAATCATTCGGTT[T(BHQ-1)]ACGGCG TTG TTACC[spacer C3]-3' (SEQ ID NO:13) SA_Con_m1 5'-[6- FAM]CACCTCGTGGTCAATCATTCGGTT[T(BHQ-1)]ACGGCGTTGTTACC[spacer C3]-3' (SEQ ID NO:14) (Bold underlined letters indicate mismatched nucleotides.)
[0359] The exonucleolytic reaction was conducted in the final volume of 20 μl containing 0.2 pmols of the synthetic oligonucleotide from S. aureus (SEQ ID NO: 1), 5 pmols of the dual-labeled probe (SEQ ID NO: 7, 12, 13 or 14), and 10 µl 2X Master Mix containing 6 mM MgCl 2 , 200 µM dNTPs, and 2 units DiaStarTMTaq DNA polymerase (Solgent, Korea); the tube containing the reaction mixture was placed in the real-time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 2 min at 95°C and subjected to 40 cycles of 20 seconds at 95°C, and for 60 seconds at 60°C. The detection of the generated signal was carried out in the hybridization step (60°C) of each cycle.
[0360] As shown in figure 10, the fluorescent signal from the target nucleic acid sequence was generated, when the dual-labeled TD probe having the matched sequence in its second 5' hybridization portion was used (No. 1). Interestingly, in the case of the TD probe having three mismatched nucleotides in its second 5' hybridization portion, no signal was observed (No. 3). In contrast, when conventional probes having three mismatched nucleotides as well as having the compatible sequence at their 5' end portions were used (Nos. 5 and 7), signals were generated. There was no signal in the absence of the mold as a negative control (Nos. 2, 4, 6 and 8)
[0361] These results showed that in contrast to the TD probe, the conventional probe generated the false-positive signal in non-specific hybridization. Hence, it can be understood that a TD probe can detect a target nucleic acid sequence without false positive signals. EXAMPLE 4: Real-time PCR using a TD probe for the detection of a target nucleic acid sequence
[0362] We apply the TD probe in real-time PCR reaction for the detection of a target nucleic acid sequence with a DNA polymerase having 5' to 3' exonuclease activity.
[0363] For this patent application, genomic DNAs of Staphylococcus aureus and Neisseria gonorrhoeae were extracted from each cell line and used. The TD probe has a compatible or incompatible sequence in its second 5' hybridization portion. Both of a reporter molecule and a suppressor molecule were positioned on the second 5' hybridization portion of the dual-labeled TD probe. C. Real-Time PCR for Detection of the S. aureus Gene When the S. aureus gene target nucleic acid sequence is used as a template, the primer sequences and dual-labeled TD probes used in this Example are: SA_F 5'-TGTTAGAATTTGAACAAGGATTTAAIIIIITAGCGACTTT-3' (SEQ ID NO:15) SA_R 5'-GATAAGTTTAAAGCTTGACCGTCIIIIITGATAGCGAT-3' (SEQ ID NO:16) SA_TD2_M 5'-[6-FAM]CATTCCG[T(BHQCG-TTTIICGG TCTTIII]GG [C3 spacer]-3' (SEQ ID NO:17) SA_TD2_m 5'-[6-FAM]TGCCTTA[T(BHQ-1)]] AAIIIIICATTCGGTTTA CGGCG TTG TTACC[C3 spacer]-3' (SEQ ID NO:18 ); (Underlined and bold letters indicate incompatible nucleotides.)
[0364] Real-time PCR reaction was conducted in the final volume of 20 μl containing 1 ng of S. aureus genomic DNA, 5 pmols of dual-labeled TD probe (SEQ ID NO: 17 or 18), 10 pmols of sense primer forward (SEQ ID NO: 15), 10 pmols antisense primer (SEQ ID NO: 16) and 10 µl 2X Master Mix containing 6 mM MgCl2, 200 µM dNTPs, and 2 units DiaStarTM Taq DNA polymerase (Solgent , Korea); the tube containing the reaction mixture was placed in the real-time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 2 min at 95°C and subjected to 40 cycles of 20 seconds at 95°C, and for 60 seconds at 60°C. The detection of the generated signal was carried out in the hybridization step (60°C) of each cycle.
[0365] As shown in Figure 11A, the fluorescent target signal from the S. aureus gene was generated when the dual-labeled TD probe having the matched sequence in its second 5' hybridization portion was used (No. 1). On the other hand, no fluorescent signal from the target nucleic acid sequence of the S. aureus gene was observed in the case of using the dual-labeled TD probe having the mismatched sequence in its second 5' hybridization portion (No. 3), indicating that the reporter molecule and the suppressor molecule positioned on the second 5' hybridization moiety were not separated. There was no signal in the absence of the template as a negative control (Nos. 2 and 4) D. Real-time PCR for detection of the N. gonorrhoeae gene.
[0366] When the target nucleic acid sequence of the N. gonorrhoeae gene is used as a template, the sequences of the primers and dual-labeled TD probes used in this Example are: NG_F 5'-TACGCCTGCTACTTTCACGCTIIIIIGTAATCAGATG-3' (SEQ ID NO :19) NG_R 5'-CAATGGATCGGTATCACTCGCIIIIICGAGCAAGAAC-3' (SEQ ID NO:20) NG_TD2_M 5'-[6-FAM]AGCATCA [T(BHQ- 1)]GCIIIIIIATTGGCGTGTTTCGC ATA TTTAAG [spacer C3]-3' (SEQ ID :21); NG_TD2_m 5'-[6-FAM]GATGCTG[T(BHQ-1)]ATIIIIIATTGGCGTGTTTCGCA TATTTAAG [C3 spacer]-3' (SEQ ID NO:22); (Underlined and bold letters indicate incompatible nucleotides.)
[0367] The real-time PCR reaction was conducted as the same protocol used for S. aureus, except for the template (1 ng of N. gonorrhoeae), dual-labeled TD probes (SEQ ID NOs: 21 and 22), and primers ( SEQ ID NOs: 19 and 20)
[0368] As shown in Figure 11B, the fluorescent target signal from the N. gonorrhoeae gene was generated when the dual-labeled TD probe having the matched sequence in its second 5' hybridization portion was used (No. 1). On the other hand, no fluorescent signal from the target nucleic acid sequence of the N. gonorrhoeae gene was observed in the case of using the dual-labeled TD probe having the mismatched sequence in its second 5' hybridization portion (No. 3), indicating that the reporter molecule and the suppressor molecule positioned on the second 5' hybridization moiety were not separated. There was no signal in the absence of the mold as a negative control (Nos. 2 and 4).
[0369] These results showed that the TD probe which has an interactive labeling system in its second 5' hybridization portion can be used in real-time PCR to discriminate a target nucleic acid sequence from a non-target nucleic acid sequence . EXAMPLE 5: Discrimination of single nucleotide variation using a dual-labeled TD probe in real-time PCR reaction
[0370] It is examined whether a TD probe can discriminate a single nucleotide variation in a nucleic acid sequence.
[0371] For this examination, the TD probe has a matched sequence or a single mismatched nucleotide in its second 5' hybridization portion. Both of a reporter molecule and a suppressor molecule were positioned in their second 5' hybridization portion of the dual-labeled TD probe.
[0372] S. aureus genomic DNA is used as a template. The sequences of the dual-labelled TD probes and primers used in this Example are: SA_F 5'-TGTTAGAATTTGAACAAGGATTTAAIIIIITAGCGACTTT-3' (SEQ ID NO:15) SA_R 5'-GATAAGTTTAAAGCTTGACCGTCIIIIITGATAGCGAT-3' (SEQ ID NO:16) SA_TD_S 6-FAM]TTCCG[T(BHQ-1)] GGIIIIICATTCGGTTTACGGCGTTGTTACC [Spacer C3]-3' (SEQ ID NO:23) SA_TD_S_m 5'-[6-FAM]TTCTG[T(BHQ-1)] GGIIIIICATTCGGTTTACGGCGTTG3CC[ Spacer ]-3' (SEQ ID NO:24)
[0373] The real-time PCR reaction was conducted in the final volume of 20 μl containing 500 pg of S. aureus genomic DNA, 5 pmols of the dual-labeled TD probe (SEQ ID NO: 23 or 24), 10 pmols of the primer forward sense (SEQ ID NO: 15), 10 pmols antisense primer (SEQ ID NO: 16) and 10μl 2X Master Mix containing 6 mM MgCl2, 200μM dNTPs, and 2 units DiaStarTMTaq DNA polymerase (Solgent , Korea); the tube containing the reaction mixture was placed in the real-time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 2 min at 95°C and subjected to 40 cycles of 20 seconds at 95°C, and for 60 seconds at 63°C. The detection of the generated signal was carried out in the hybridization step (63°C) of each cycle.
[0374] As shown in Figure 12, the fluorescent signal from S. aureus was generated when the dual-labeled TD probe having a compatible sequence in its second 5' hybridization portion was used (No. 1). On the other hand, no fluorescent signal was observed in the case of using the dual-labeled TD probe having an incompatible single nucleotide in its second 5' hybridization portion (No. 3). There was no signal in the absence of the mold as a negative control (Nos. 2 and 4).
[0375] These results showed the hybridization model different from the TD probe even depending on the single nucleotide mismatch in its second 5' hybridization portion. Hence, it can be understood that a TD probe has high specificity to discriminate single nucleotide variation including SNP without false positive signals in real-time PCR reaction. EXAMPLE 6: Evaluation of a TD probe immobilized on solid phase using an enzyme having a 5' to 3' exonuclease activity
[0376] We further evaluated whether an immobilized TD probe can discriminate a target nucleic acid sequence from a non-target nucleic acid sequence using an enzyme having a solid phase 5' to 3' exonuclease activity.
[0377] To examine this evaluation, the synthetic oligonucleotide for the Staphylococcus aureus (SA) gene was used as a template. The TD probe has a compatible or a mismatched sequence in its second 5' hybridization portion. The TD probe has a Quasar570 as a fluorescent reporter molecule on its first 3' hybridization moiety, a Black Hole Suppressor 2 (BHQ-2) as a suppressor molecule on its 5' end and poly(T)7 as a linker arm. Dual-labeled TD probes were immobilized on the surface of the solid substrate using an amino group (AminnoC7) at its 3' end. Bst DNA polymerase having a 5' to 3' exonuclease activity was used for 5' to 3' exonucleolytic reactions.
[0378] The synthetic template sequences and the dual-labeled TD probes used in this Example are: SA_T70 5'-GGTGTAGGTGGTGGCGGTAACAACGCCGTAAACCG AATGATTGACCACGGAATGAATAATGTTGAATTTA-3' (SEQ ID NO: 1) SA_TD1_Chip_M 5'-[CTTACCTCGGTQIII] [AminoC7]-3' (SEQ ID NO: 25) SA_TD1_ChiP_m 5'-[BHQ-2]TGCCTTATAAIIIIICATTCGGTT[T (Quasar570)]ACGGCGTTGTTACCTTTTTT[AminoC7] (SEQ ID NO: 26) (Underlined and bold letters indicate the incompatible nucleotides .)
[0379] NSB9 NHS slides (NSBPOSTECH, Korea) were used for the fabrication of two different types of TD probes (SEQ ID NO: 25 and 26). TD probes dissolved in NSB seeding buffer at a final concentration of 20 µM were printed onto NSB9 NHS slides with OmniGrid Accent Microarrayer (DIGILAB, US). Each TD probe was seeded side-by-side in a 2x1 format (double dots), and the resulting microarray was incubated in a chamber kept at ~85% humidity overnight. The slides were then washed in a buffer solution containing 2xSSPE (0.3 M sodium chloride, 0.02 M sodium hydrogen phosphate and 2.0 mM EDTA), pH 7.4 and 7.0 mM SDS at 37° C for 10 min to remove non-specifically bound TD probe and rinse with distilled water. Then, DNA-functionalized slides were dried using a slide centrifuge and stored in the dark at 4°C until use.
[0380] The exonucleolytic reaction was conducted on the surface of the DNA-functionalized slide in the final volume of 30 μl containing 10 pmols of synthetic SA oligonucleotide (SEQ ID NO: 1), and 3 μl of 10x reaction buffer, 0.6 μl of 10 mM each of dNTPs, 2 units Bst DNA polymerase (NEB, USA). The entire mixture was applied to a chamber mounted on the surface of the NSB glass slide to which the TD probes were interconnected. The slide was placed in the in situ block in a thermocycler (Genepro B4I, China). The exonucleolytic reaction was carried out for 30 min at 50°C and stopped by washing at 95°C for 1 min with distilled water. Image acquisition was performed using the Confocal Laser Digitizer, Axon GenePix4100A (Molecular Devices, US) with scanning at 5 μm resolution per pixel. Fluorescence intensity was analyzed using the quantitative microarray analysis program, the GenePix pro5.1 program (Molecular Devices, US). Fluorescence intensity was expressed as midpoints after subtractions from the local reference. Each point was duplicated for reproducibility testing. Fluorescence intensity indicates the mean value of the duplicated dots.
[0381] As shown in Figure 13, the fluorescent signal from S. aureus was generated when the dual-labeled TD probe having the matched sequence in its second 5' hybridization portion was used with the template (SA_TD1_Chip_M, RFU 65472.0±4 ,two). On the other hand, no fluorescent signal from S. aureus was observed in the case of using the dual-labeled TD probe having the mismatched sequence in its second 5' hybridization portion (SA_TD1_Chip_m, RFU 3227.0 ± 17.0). There was no signal in the absence of the mold as a negative control (SA_TD1_Chip_M, RFU 2798.0 ±4.2 or SA_TD1_Chip_m, RFU 3077.0 ±9.9).
[0382] These results showed that the immobilized TD probe can be applied to microarray assays to discriminate target nucleic acid sequences from non-target nucleic acid sequences. EXAMPLE 7: Effect of the second 5' hybridization portion of immobilized TD probes
[0383] It is examined that immobilized TD probes can eliminate false positive signals in solid phase by the effect of the second portion of 5' hybridization.
[0384] For this examination, the synthetic oligonucleotide gene from Staphylococcus aureus (SA) was used as a template. The TD probe has a matched sequence or three mismatched nucleotides in its second 5' hybridization portion. Conventional probes have the same sequences as TD probes except deoxynosine. TD and conventional probes have Quasar570 as a fluorescent reporter molecule in their first 3' hybridization portion, Black Hole Suppressor 2 (BHQ-2) as a suppressor molecule at its 5' end and poly(T)7 as a linker arm. Dually labeled probes were immobilized on the surface of the solid substrate using an amino group (AminnoC7) at their 3' ends. Bst DNA polymerase having a 5' to 3' exonuclease activity was used for 5' to 3' exonucleolytic reactions.
[0385] The sequences of the synthetic template and the dual-labeled TD and conventional probes used in this Example are: SA_T70 5'-GGTGTAGGTGGTGGCGGTAACAACGCCGTAAACC GAATGATTGACCACGGAATGAATAATGTTG AATTTA-3' (SEQ ID NO: 1) SA_TD1_Chip_M 5'-[BTGGITTAGHQIII] )]ACGGCGTTGTTACC TTTTT[AminoC7]-3' (SEQ ID NO: 25) SA_TD1_ChiP_m1 5'-[BHQ-2]CACCTCGTGGIIIIICATTCGGTT[T (Quasar570)]ACGGCGTTGTTACC TTTTT[AminoC7]-3' (SEQ_Con NO: 27) '- [BHQ-2]CATTCCGTGGTCAATCATTCGGTT[T (Quasar570)]ACGGCGTTGTTACC TTTTT[AminoC7]-3' (SEQ ID NO: 28) SA_Con_Chip_m1 5'- [BHQ-2]CACCTCGTGGTCAATCATTCGGTT[TACCTTACTT[7]TTGTT[GTT]GTT[7] -3' (SEQ ID NO: 29) (Bold underlined letters indicate incompatible nucleotides.)
[0386] NSB9 NHS slides (NSBPOSTECH, Korea) were used for manufacturing the probes (SEQ ID NOs: 25, 27, 28 and 29). Each probe dissolved in NSB seeding buffer at a final concentration of 20 µM was printed on the NSB9 NHS slide with OmniGrid Accent Microarrayer (DIGILAB, US). Each probe was seeded side by side in a 2x1 format (double dots), and the resulting microarray was incubated in a chamber kept at ~85% humidity overnight. The slides were then washed in a buffer solution containing 2xSSPE (0.3 M sodium chloride, 0.02 M sodium hydrogen phosphate and 2.0 mM EDTA), pH 7.4 and 7.0 mM SDS at 37° C for 10 min to remove non-specifically bound probes and rinse with distilled water. Then DNA-functionalized slides were dried using a slide centrifuge and stored in the dark at 4°C until use.
[0387] The exonucleolytic reaction was conducted on the surface of the DNA-functionalized slide in the final volume of 30 μl containing 10 pmols of synthetic SA oligonucleotide (SEQ ID NO: 1), and 3 μl of 10x reaction buffer, 0.6 μl of 10 mM each of dNTPs, 2 units Bst DNA polymerase (NEB, USA). The entire mixture was applied to a chamber mounted on the surface of the NSB glass slide to which the probes were interconnected. The slide was placed in the in situ block in a thermocycler (Genepro B4I, China). The exonucleolytic reaction was carried out for 30 min at 50°C and stopped by washing at 95°C for 1 min with distilled water. Image acquisition was performed using the Confocal Laser Digitizer, Axon GenePix4100A (Molecular Devices, US) with scanning at 5 μm resolution per pixel. Fluorescence intensity was analyzed using the quantitative microarray analysis program, GenePix pro5.1 program (Molecular Devices, US). Fluorescence intensity was expressed as midpoints after subtractions from the local reference. Each point was duplicated for reproducibility testing. Fluorescence intensity indicates the mean value of the duplicated dots.
[0388] As shown in Figure 14, the fluorescent signal from the target sequence of SA nucleic acids was generated when the immobilized dual-labeled TD probe having a compatible sequence in its second 5' hybridization portion was used with the template (SA_TD1_Chip_M, RFU: 65467.0±5.7). In case of using the TD probe having three mismatched nucleotides in its second 5' hybridization portion, no signal was observed (SA_TD1_Chip_m1, RFU: 6679.5 ±222.7). On the other hand, signals were generated when conventional probes having three mismatched nucleotides (SA_Con_Chip_m1, RFU: 65464.0±5.7) as well as having the compatible sequence (SA_Con_Chip_M, RFU: 65464.5±6.4) were used . There was no signal in the absence of the mold as a negative control (SA_TD1_Chip_M, RFU: 2716.5 ±12.0) (SA_TD1_Chip_m1, RFU: 2810.5 ±14.8) (SA_Con_Chip_m1, RFU: 3216.5 ±41.7 ) (SA_Con_Chip_M, RFU: 2749.5 ± 19.1)
[0389] These results showed that in contrast to the immobilized TD probe, the immobilized conventional probe generated the false-positive signal in non-specific hybridization. Hence, it can be understood that immobilized TD probes can detect target nucleic acid sequences without false positive signals. EXAMPLE 8: Detection of Target Nucleic Acid Sequences Using Unique TD-labeled Probes Immobilized on Solid Substrate Surface
[0390] We still apply unique labeled TD probes for the detection of target sequences of nucleic acids in the solid phase.
[0391] For this patent application, the synthetic oligonucleotide gene from Staphylococcus aureus (SA) was used as a template. A TD probe has a compatible or a mismatched sequence in its second 5' hybridization portion. The TD probe has 6-FAM or 6-TAMRA (6-Carboxitetramethylrhodamine) as a fluorescent reporter molecule at its 5' end and poly(T)7 as a linker arm. The single labeled TD probe was immobilized on the surface of the solid substrate using an amino group (AminnoC7) at its 3' end. Bst or Taq polymerase having a 5' to 3' exonuclease activity were used for 5' to 3' exonucleolytic reactions. E. Signal generation performing exonucleolytic reaction
[0392] The synthetic template sequences and unique tagged TD probes used in this reaction are: SA_T70 5'-GGTGTAGGTGGTGGCGGTAACAACGCCGTA AACCGAATGATTGACCACGGAATGAATAATGTTG AATTTA-3' (SEQ ID NO:1) SA_TD2_Chip_M 5'-[6-TTCGTTCGTACCIII] 3' (SEQ ID NO:30) SA_TD2_Chip_m 5'-[6-FAM]TGCCTTATAAIIIIICATTCGGTTT ACGGCGTTGTTACCTTTTTT [AminoC7]-3' (SEQ ID NO:31) (Bold underlined letters indicate incompatible nucleotides.)
[0393] NSB9 NHS slides (NSBPOSTECH, Korea) were used for manufacturing the probes (SEQ ID NOs: 30 and 31). Each probe dissolved in NSB seeding buffer at a final concentration of 20 µM was printed on NSB9 NHS slide with OmniGrid Accent Microarrayer (DIGILAB, US). Each probe was seeded side by side in a 2x1 format (double dots), and the resulting microarray was incubated in a chamber kept at ~85% humidity overnight. The slides were then washed in a buffer solution containing 2xSSPE (0.3 M sodium chloride, 0.02 M sodium hydrogen phosphate and 2.0 mM EDTA), pH 7.4 and 7.0 mM SDS at 37° C for 10 min to remove non-specifically bound probes and rinse with distilled water. Then DNA-functionalized slides were dried using a slide centrifuge and stored in the dark at 4°C until use.
[0394] The exonucleolytic reaction was conducted on the surface of the DNA-functionalized slide in the final volume of 30 μl containing 10 pmols of synthetic SA oligonucleotide (SEQ ID NO: 1), and 3 μl of 10x reaction buffer, 50 μM of each one of dNTPs, 2 units of Bst DNA polymerase. The entire mixture was applied to a chamber mounted on the surface of the NSB glass slide to which the probes were interconnected. The slide was placed in the in situ block of a thermocycler (Genepro B4I, China). The exonucleolytic reaction was carried out for 30 min at 50°C and stopped by washing at 95°C for 1 min with distilled water. Image acquisition was performed using the Confocal Laser Digitizer, Axon GenePix4300A (Molecular Devices, USA) with scanning at 5 μm resolution per pixel. Fluorescence intensity was analyzed using the quantitative microarray analysis program, GenePix program (Molecular Devices, USA). Fluorescence intensity was expressed as midpoints after subtractions from the local reference. Each point was duplicated for reproducibility testing. Fluorescence intensity indicates the mean value of the duplicated dots. F. Signal generation performing cyclic exonucleolytic reaction
[0395] The synthetic template sequences and unique tagged TD probes used in this reaction are: SA_T70 5'-GGTGTAGGTGGTGGCGGTAACAACGCCGTA AACCGAATGATTGACCACGGAATGAATAATGTTG AATTTA-3' (SEQ ID NO:1) SA_TD2_Chip_M_2 5'-[CTTCGTCGTMI]GTTCGTGImin -3' (SEQ ID NO:32) SA_TD2_Chip_m_2 5'-[6-TAMRA]TGCCTTATAAI IIIICA TTCGGTTTACGGCGTTG TTACCTTTTT[AminoC7]-3' (SEQ ID NO:33) (Bold underlined letters indicate incompatible nucleotides.)
[0396] NSB9 NHS slides (NSBPOSTECH, Korea) were used for manufacturing the probes (SEQ ID NOs: 32 and 33). Each probe dissolved in NSB seeding buffer at a final concentration of 20 µM was printed on NSB9 NHS slide with OmniGrid Accent Microarrayer (DIGILAB, US). Each probe was seeded side by side in a 2x1 format (double dots), and the resulting microarray was incubated in a chamber kept at ~85% humidity overnight. The slides were then washed in a buffer solution containing 2xSSPE (0.3 M sodium chloride, 0.02 M sodium hydrogen phosphate and 2.0 mM EDTA), pH 7.4 and 7.0 mM SDS at 37° C for 10 min to remove non-specifically bound probes and rinse with distilled water. Then DNA-functionalized slides were dried using a slide centrifuge and stored in the dark at 4°C until use.
[0397] The cyclic exonucleolytic reaction was conducted on the surface of the DNA-functionalized slide in the final volume of 30 μl containing 10 pmols of synthetic SA oligonucleotide (SEQ ID NO: 1), and 3 μl of 10x reaction buffer (5 mM MgCl2 ), 50 µM each of dNTPs, 2 units of Taq DNA polymerase (Solgent, Korea). The entire mixture was applied to a chamber mounted on the surface of the NSB glass slide to which the probes were interconnected. The slide was placed in the in situ block in a thermocycler (Genepro B4I, China). Thermocycling was performed as follows: denaturation for 2 min at 95°C and one cycle (5, 10, 20, 30, 40 or 50 cycles) of 95°C for 20 seconds and 55°C for 20 seconds. Image acquisition was performed using the Confocal Laser Digitizer, Axon GenePix4100A (Molecular Devices, USA) with scanning at 5 μm resolution per pixel. Fluorescence intensity was analyzed using the quantitative microarray analysis program, GenePix program (Molecular Devices, USA). Fluorescence intensity was expressed as midpoints after subtractions from the local reference. Each point was duplicated for reproducibility testing. Fluorescence intensity indicates the mean value of the duplicated dots.
[0398] In case of the exonucleolytic reaction, when the immobilized single labeled TD probe having a compatible sequence in its second 5' hybridization portion was used with the template, the fluorescent signal on the solid substrate was finally eliminated. In case of the cyclic exonucleolytic reaction, the fluorescent intensity on the solid substrate was reduced depending on the number of cycles. EXAMPLE 9: Detection of a single nucleotide variation using a TD probe and solid phase ligase
[0399] It is examined if a TD probe can discriminate a single nucleotide variation in a nucleic acid sequence by a solid phase ligase reaction.
[0400] For this examination, a first probe having DSO structure has Quasar570 as a reporter molecule at its 5' end and is used as a mobilized probe. The TD probe as a second probe has a matched sequence or a single mismatched nucleotide in its second 5' hybridization portion. The TD probe has poly(T)7 as a linker arm. The TD probe was immobilized on the surface of the solid substrate using an amino group (AminnoC7) at its 3' end. The synthetic oligonucleotide for the Staphylococcus aureus (SA) gene was used as a template. Thermostable DNA Ligase Ampligase was used for ligation.
[0401] The sequences of the synthetic template and the first and second probe (TD) used in this Example are: SA_T110: '- TGTAGGTGGTGGCGGTAACAACGCCGTAAACCGAATGATT GA CCACGGAATGAATAATGTTGAA TTTATCGCTATCAACACAGACGGTCAAGCTTTAAACTTATCTAACT_TAG_GTTIII'(CGTT)GCTT_GTT_GTT_3'CGGIII (CGTT-34) ]-3' (SEQ ID NO:35) SA_TD_Chip_S_m:'-TTCTGTGGIIIIICATTCGGTTTACGGCGTTGTTACCT TTTT[AminoC7]-3' (SEQ ID NO:36) SA_Chip_DSO: 5'- [Quasar570]ACCGTCTG -3 TTGATAGCGA TAA (The underlined and bold letter indicates the incompatibility nucleotide.)
[0402] NSB9 NHS slides (NSBPOSTECH, Korea) were used for the fabrication of the TD probes (SEQ ID NOs: 35 and 36). Each probe dissolved in NSB seeding buffer at a final concentration of 20 µM was printed on NSB9 NHS slide with OmniGrid Accent Microarrayer (DIGILAB, US). Each probe was seeded side by side in a 2x1 format (double dots), and the resulting microarray was incubated in a chamber kept at ~85% humidity overnight. The slides were then washed in a buffer solution containing 2xSSPE (0.3 M sodium chloride, 0.02 M sodium hydrogen phosphate and 2.0 mM EDTA), pH 7.4 and 7.0 mM SDS at 37° C for 10 min to remove non-specifically bound probes and rinse with distilled water. Then DNA-functionalized slides were dried using a slide centrifuge and stored in the dark at 4°C until use.
[0403] The ligase reaction was conducted on the surface of the DNA-functionalized slide in the final volume of 30 µl containing 10 pmols of SA synthetic template (SEQ ID NO: 34), 5 pmols of the first probe (SEQ ID NO: 37) and 3 µl of 10x Ampligase reaction buffer containing 20 mM Tris-HCl (pH 8.3), 25 mM KCl, 10 mM MgCl 2 , 0.5 mM NAD, and 0.01% Triton® X-100, 0.2 μl Thermostable DNA Ligase Ampligase (5 U/μl) (Epicentre Biotechnologies, USA). The entire mixture was applied to a chamber mounted on the surface of the NSB glass slide to which the probes were interconnected. The reaction was carried out as follows: the target nucleic acid hybridization, the first probe and the immobilized TD probe were carried out at 45°C for 5 min and the ligase reaction was further carried out for 30 min at 65°C. The reaction was stopped and denaturation was carried out by washing at 95°C for 2 min with distilled water. Image acquisition was performed using the Confocal Laser Digitizer, Axon GenePix4100A (Molecular Devices, USA) with scanning at 5 μm resolution per pixel. Fluorescence intensity was analyzed using the quantitative microarray analysis program, GenePix program (Molecular Devices, USA). Fluorescence intensity was expressed as midpoints after subtractions from the local reference. Each point was duplicated for reproducibility testing. Fluorescence intensity indicates the mean value of the duplicated dots.
[0404] The fluorescent signal from the SA nucleic acid target sequence was generated when the TD probe having a compatible sequence in its second 5' hybridization portion was used as the second probe with template. In case of using the TD probe having single mismatched nucleotide in its second 5' hybridization portion as the second probe, no signal was observed. These results demonstrate that our ligation reaction allows detection of a single nucleotide variation. EXAMPLE 10: Fluorescence detection of target nucleic acid sequence changes in hybridization of the second 5' hybridization portion of the TD probe
[0405] It is examined whether a TD probe having a fluorescent molecule in its second 5' hybridization portion can be applied for a Target Detection based on the modification of fluorescent signal depending on the hybridization of the labeled portion.
[0406] For this patent application, genomic DNA from Staphylococcus aureus was used as a template. The TD probe has a compatible or incompatible sequence in its second 5' hybridization portion. The fluorescent molecule was attached to the inner nucleotide of the second 5' hybridization portion of the TD probe. A template-dependent nucleic acid polymerase having no 5' to 3' exonuclease activity was used for target amplification.
[0407] The sequences of the primers and labeled single TD probes used in this Example are: SA_F 5'-TGTTAGAATTTGAACAAGGATTTAAIIIIITAGCGACTTT-3' (SEQ ID NO:15) SA_R 5'-GATAAGTTTAAAGCTTGACCGTCIIIIITGATAGCGAT-3' (SEQ ID NO:16) SA_TD '-CATTCCG[T(FAM)]GGIIIIICATTCGGTTTACGGCG TTGTTACC [Spacer C3]-3' (SEQ ID NO:38) SA_TD3_m 5'-TGCCTTA[T(FAM)]] AAIIIIICATTCGGTTTACGGCG TTGTTACC[Spacer C3]-3' (SEQ ID NO :39); (Underlined and bold letters indicate incompatible nucleotides.)
[0408] Real-time PCR reaction was conducted in the final volume of 20 μl containing 1 ng of S. aureus genomic DNA, 5 pmols of the single labeled TD probe (SEQ ID NO: 38 or 39), 10 pmols of the primer forward sense (SEQ ID NO: 15), 10 pmols antisense primer (SEQ ID NO: 16), 2 µl 10X Stoffel buffer [containing 100 mM Tris-HCl (pH 8.3) and 100 mM KCl] , 200 µM each of the four dNTPs (dATP, dCTP, dGTP and dTTP), 5 mM MgCl2 and 1 unit AmpliTaq® DNA polymerase, Stoffel Fragment (Applied BioSystems, US); the tube containing the reaction mixture was placed in the real-time thermocycler (CFX96, Bio-Rad); the reaction mixture was denatured for 2 min at 95°C and subjected to 40 cycles of 20 seconds at 95°C, for 30 seconds at 55°C, and for 10 seconds at 72°C. The detection of the generated signal was carried out in the hybridization step (55°C) of each cycle.
[0409] Our experimental results address that the TD probe allows detecting target sequences with discrimination by measuring the fluorescent modification of a single label molecule depending on the hybridization of the second 5' hybridization moiety.
[0410] Having described a preferred embodiment of the present invention, it is to be understood that variants and modifications thereof which are included in the spirit of the invention may be apparent to those skilled in the art, and the scope of this invention shall be determined by the appended claims and their equivalents.

权利要求:
Claims (34)
[0001]
1. Distinctive target probe (TD probe), characterized by the fact that it has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I to allow discrimination of a target nucleic acid sequence from a non-target sequence of nucleic acids: 5'-X'p-Y'q-Z'r-3' (I) wherein, X'p represents a second 5' hybridization moiety having a hybridization nucleotide sequence complementary to the target sequence of nucleic acids; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the length of the second 5' hybridization portion is 3-15 nucleotides, the length of the first 3' hybridization portion is 15-60 nucleotides, and the first 3' hybridization portion is longer than the second 5' hybridization portion ; the TD probe has a single tag or an interactive tag system containing a plurality of tags to generate a detectable signal; the single tag is a single chemical tag, a single enzymatic tag, a single fluorescent tag, a single luminescent tag, a single chemiluminescent tag, or a single metallic tag; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased; wherein when the TD probe is hybridized to the target nucleic acid sequence, both the second 5' hybridization moiety and the first 3' hybridization moiety will be hybridized to the target nucleic acid sequence; wherein when the TD probe is hybridized with the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand, whereby the TD probe allows to discriminate the target nucleic acid sequence from non-target nucleic acid sequence; wherein the unique label is positioned on the second 5' hybridization portion of the TD probe; wherein when the TD probe has a single label on its second 5' hybridization portion, the TD probe comprises a linker at its 3' end for immobilizing the TD probe on the surface of a solid substrate; wherein the interactive labeling system comprises a reporter molecule and a suppressor molecule and (i) the reporter molecule and the suppressor molecule are all positioned in the second 5' hybridization portion; (ii) the reporter molecule and the inhibitor molecule each are positioned in each different portion of the second 5' hybridization portion and the separation portion; or (iii) the reporter molecule and the suppressor molecule are each positioned on each different portion of the second 5' hybridization portion and the first 3' hybridization portion.
[0002]
2. Probe according to claim 1, characterized in that the separating portion is 3-10 nucleotides in length.
[0003]
3. Method for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe), characterized in that it comprises the steps of: (a) hybridization of the target sequence of nucleic acids with the TD probe having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I) where, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe is double labeled with a fluorescent reporter molecule and a quencher molecule capable of quenching the reporter molecule's fluorescence; at least one of the fluorescent reporter molecule and the suppressor molecule is positioned over the second 5' hybridization portion; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the length of the second 5' hybridization portion is 3-15 nucleotides, the length of the first 3' hybridization portion is 15-60 nucleotides, and the first 3' hybridization portion is longer than the second 5' hybridization portion ; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased; wherein (i) the fluorescent reporter molecule and the suppressor molecule are all positioned in the second 5' hybridization portion; (ii) the fluorescent reporter molecule and the quencher molecule are each positioned on each different portion of the second 5' hybridization portion and the separation portion; or (iii) the fluorescent reporter molecule and the quencher molecule are each positioned on each different portion of the second 5' hybridization portion and the first 3' hybridization portion; wherein when the TD probe is hybridized to the target nucleic acid sequence, both the second 5' hybridization moiety and the first 3' hybridization moiety will be hybridized to the target nucleic acid sequence and the second 5' hybridization moiety ' will be digested by an enzyme having a 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand such that the second 5' hybridization portion is not digested by the enzyme having activity a 5' to 3' exonuclease, whereby the TD probe makes it possible to discriminate target nucleic acid sequence from non-target nucleic acid sequence; (b) contacting the resultant of step (a) to the enzyme having 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the target nucleic acid sequence, the second 5' hybridization portion is digested by the enzyme having 5' to 3' exonuclease activity to separate the fluorescent reporter molecule from the suppressor molecule in the TD probe, resulting in generation of a fluorescence signal; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, the second 5' hybridization portion is not digested by the enzyme having 5' to 3' exonuclease activity, resulting in no fluorescence signal; and (c) detecting the fluorescence signal, such that the fluorescence signal generated by digestion at the second 5' hybridization portion is indicative of the presence of the target nucleic acid sequence.
[0004]
4. Method according to claim 3, characterized in that the enzyme having 5' to 3' exonuclease activity is a template-dependent nucleic acid polymerase having 5' to 3' exonuclease activity.
[0005]
5. Method according to claim 3, characterized in that step (a) is performed using the TD probe together with an upstream primer to be hybridized with a site downstream of a hybridized site of the TD probe and the enzyme having 5' to 3' exonuclease activity is a template-dependent nucleic acid polymerase having 5' to 3' exonuclease activity such that the upstream primer is extended by the template-dependent nucleic acid polymerase in step (b).
[0006]
6. Method according to claim 3, characterized in that step (a) is performed using the TD probe in conjunction with an antisense primer and the enzyme having 5' to 3' exonuclease activity is a polymerase of Template dependent nucleic acids having 5' to 3' exonuclease activity such that step (b) produces the target nucleic acid sequence hybridizable to the TD probe by an antisense primer extension reaction by the dependent nucleic acid polymerase of mold.
[0007]
7. Method according to claim 3, characterized in that the method further comprises the repetition of steps (a) - (b) or (a) - (c) with denaturation between repetition cycles.
[0008]
8. Method according to claim 3, characterized in that the target nucleic acid sequence comprises at least two types of nucleic acid sequences and the TD probe comprises at least two types of probes.
[0009]
9. Method according to claim 5, characterized in that the target nucleic acid sequence comprises at least two types of nucleic acid sequences, the TD probe comprises at least two types of probes and the upstream primer comprises at least at least two types of primers or the antisense primer comprises at least two types of primers.
[0010]
10. Method according to claim 3, characterized in that the target nucleic acid sequence comprises a nucleotide variation, the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second portion of 5' hybridization of the TD probe, and the TD probe presents a sequence corresponding to the nucleotide variation in its second 5' hybridization portion.
[0011]
11. Method according to claim 3, characterized in that the TD probe has a blocking site containing as a blocker at least one nucleotide resistant to cleavage by the enzyme having 5' to 3' exonuclease activity and the blocking site is positioned in the first 3' hybridization portion of the TD probe.
[0012]
12. Method for detecting a target nucleic acid sequence in a solid phase of DNA or a mixture of nucleic acids using a distinctive target probe (TD probe), characterized in that it comprises the steps of: (a) hybridization of target nucleic acid sequence with the TD probe having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence; wherein the TD probe is immobilized by its 3' end to the surface of the solid substrate; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I) where, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe has a tag generating a detectable signal or an interactive tag system containing a plurality of tags generating a detectable signal and the tag is positioned over the second 5' hybridization portion of the TD probe; the label is a chemical label, an enzymatic label, a fluorescent label, a luminescent label, a chemiluminescent label or a metallic label; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the length of the second 5' hybridization portion is 3-15 nucleotides, the length of the first 3' hybridization portion is 15-60 nucleotides, and the first 3' hybridization portion is longer than the second 5' hybridization portion ; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased; wherein when the TD probe is hybridized to the target nucleic acid sequence, both the second 5' hybridization moiety and the first 3' hybridization moiety will be hybridized to the target nucleic acid sequence and the second 5' hybridization moiety ' will be digested by the enzyme having 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand such that the second 5' hybridization portion is not digested by the enzyme having activity a 5' to 3' exonuclease, whereby the TD probe makes it possible to discriminate target nucleic acid sequence from non-target nucleic acid sequence; (b) contacting the resultant of step (a) to the enzyme having 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the target nucleic acid sequence, its second 5' hybridization portion will be digested by the enzyme having 5' to 3' exonuclease activity to release the tag from the TD probe, resulting in a modification of signal on the TD probe immobilized on the solid substrate; wherein when the TD probe is hybridized with the non-target nucleic acid sequence, the second 5' hybridization portion is not digested by the enzyme having 5' to 3' exonuclease activity, resulting in no signal modification in the immobilized TD probe on the solid substrate; whereby the signal modification on the solid substrate is detected to determine the presence of the target nucleic acid sequence; and (c) detecting the signal modification on the solid substrate, such that the signal modification by digestion at the second 5' hybridization portion is indicative of the presence of the target nucleic acid sequence.
[0013]
13. Method according to claim 12, characterized in that the marker is a fluorescent reporter molecule and the signal change is the decrease or elimination of fluorescent signals on the solid substrate.
[0014]
14. Method according to claim 12, characterized in that the interactive labeling system comprises a pair of a fluorescent reporter molecule and a suppressor molecule and the TD probe has one of the reporter molecule and the suppressor molecule at a site on the second 5' hybridization portion to be digested by the enzyme having 5' to 3' exonuclease activity and another at a site not to be digested by the enzyme having 5' to 3' exonuclease activity.
[0015]
15. Method according to claim 14, characterized in that the suppressor molecule is positioned at a site in the second 5' hybridization portion of the TD probe to be digested by the enzyme having 5' to 3' exonuclease activity and the molecule fluorescent reporter is positioned at a site not to be digested by the enzyme having 5' to 3' exonuclease activity; wherein when the TD probe is hybridized to the target nucleic acid sequence, its second 5' hybridization portion will be digested by the enzyme having 5' to 3' exonuclease activity to separate the fluorescent reporter molecule from the suppressor molecule in the TD probe, resulting in generation of a fluorescence signal; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, the second 5' hybridization portion is not digested by the enzyme having 5' to 3' exonuclease activity, resulting in no fluorescence signal; whereby the fluorescent signal on the solid substrate is detected to determine the presence of the target nucleic acid sequence.
[0016]
16. Method according to claim 12, characterized in that it further comprises the repetition of steps (a) - (b) or (a) - (c) with denaturation between repeat cycles.
[0017]
17. Method according to claim 12, characterized in that the target nucleic acid sequence comprises at least two types of nucleic acid sequences and the TD probe comprises at least two types of probes.
[0018]
18. Method according to claim 12, characterized in that the target nucleic acid sequence comprises a nucleotide variation, the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second portion of 5' hybridization of the TD probe, and the TD probe presents a sequence corresponding to the nucleotide variation in its second 5' hybridization portion.
[0019]
19. Method according to claim 12, characterized in that the TD probe has a blocking site containing as a blocker at least one nucleotide resistant to cleavage by the enzyme having 5' to 3' exonuclease activity and the blocking site is positioned in the first 3' hybridization portion of the TD probe.
[0020]
20. Method for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe) and a polymerase chain reaction (PCR), characterized in that it comprises the steps of : (a) preparation of a PCR mixture containing (i) the target nucleic acid sequence, (ii) the TD probe having a hybridization nucleotide sequence complementary to the target nucleic acid sequence, (iii) a pair of primers composed of two primers such as a sense primer and an antisense primer each having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence, and (iv) a template-dependent nucleic acid polymerase having an activity of 5' to 3' exonuclease; wherein the TD probe is hybridized to a site between the two primers; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I) where, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe is double labeled with a fluorescent reporter molecule and a quencher molecule capable of quenching the reporter molecule's fluorescence; the fluorescent reporter molecule and the quencher molecule are all positioned over the second 5' hybridization portion, or the reporter molecule and the quencher molecule are each positioned over each different portion of the second 5' hybridization portion and the separation portion; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; The Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the length of the second 5' hybridization portion is 3-15 nucleotides, the length of the first 3' hybridization portion is 15-60 nucleotides, and the first 3' hybridization portion is longer than the second 5' hybridization portion ; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased; wherein when the TD probe is hybridized to the target nucleic acid sequence, both the second 5' hybridization moiety and the first 3' hybridization moiety will be hybridized to the target nucleic acid sequence and the second 5' hybridization moiety ' will be digested by the 5' to 3' exonuclease activity of the template-dependent nucleic acid polymerase; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand such that the second 5' hybridization portion is not digested by the exonuclease activity 5' to 3' of the template-dependent nucleic acid polymerase, whereby the TD probe makes it possible to discriminate target nucleic acid sequence from non-target nucleic acid sequence; (b) amplification of the target nucleic acid sequence using PCR mixing by performing at least two cycles of primer annealing, extension and primer denaturation, wherein the two primers are extended by an acid polymerase polymerase activity template-dependent nucleic to amplify target nucleic acid sequence; wherein when the TD probe is hybridized to the target nucleic acid sequence, the second 5' hybridization moiety is digested by the 5' to 3' exonuclease activity of the template-dependent nucleic acid polymerase to separate the fluorescent reporter molecule from the suppressor molecule on the TD probe, resulting in generation of a fluorescence signal; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, the second 5' hybridization moiety is not digested by the 5' to 3' exonuclease activity of the template-dependent nucleic acid polymerase such that the fluorescent reporter molecule is not separated from the suppressor molecule on the TD probe, resulting in no fluorescence signal; and (c) detecting the fluorescence signal such that the fluorescence signal generated is indicative of the presence of the target nucleic acid sequence.
[0021]
21. Method according to claim 20, characterized in that the target nucleic acid sequence comprises at least two types of nucleic acid sequences, the TD probe comprises at least two types of probes, the forward-sense primer comprises at least two types of primers and the antisense primer comprises at least two types of primers.
[0022]
22. Method according to claim 20, characterized in that the target nucleic acid sequence comprises a nucleotide variation, the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second portion of 5' hybridization of the TD probe, and the TD probe presents a sequence corresponding to the nucleotide variation in its second 5' hybridization portion.
[0023]
23. Method for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe) by a ligation reaction, characterized in that it comprises the steps of: (a) hybridization of target nucleic acid sequence with a first probe having a hybridizing nucleotide sequence complementary to a first site of the target nucleic acid sequence and a second probe having a hybridizing nucleotide sequence complementary to a second site of the target acid sequence nucleic that is positioned upstream of the first site; wherein at least one of the first probe and the second probe has a label to generate a detectable signal and the label is a chemical label, an enzymatic label, a fluorescent label, a luminescent label, a chemiluminescent label or a metallic label; wherein the second probe is a TD probe; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I) where, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the length of the second 5' hybridization portion is 3-15 nucleotides, the length of the first 3' hybridization portion is 15-60 nucleotides, and the first 3' hybridization portion is longer than the second 5' hybridization portion ; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased; wherein when the second probe is hybridized to the target nucleic acid sequence, both the second 5' hybridization portion and the first 3' hybridization portion of the second probe will be hybridized to the target nucleic acid sequence to allow binding the first probe and the second probe; wherein when the second probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion of the second probe will form a single strand such that the first probe and second probe are not linked, whereby the second probe makes it possible to discriminate target nucleic acid sequence from non-target nucleic acid sequence; (b) binding the first probe and the second probe hybridized to the target nucleic acid sequence such that a bound probe is produced; (c) denaturation of the resultant from step (b); (d) detecting the labeling signal on the bound probe such that the signal is indicative of the presence of the target nucleic acid sequence.
[0024]
24. Method according to claim 23, characterized in that the labeling is the interactive labeling system comprising a pair of a reporter molecule and a suppressor molecule.
[0025]
25. Method according to claim 23, characterized in that the first probe has a dual specificity oligonucleotide (DSO) structure represented by the following general formula II: 5'-Xp-Yq-Zr-3' (II) wherein, Xp represents a first 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid; Yq represents a separation moiety comprising at least three universal bases, Zr represents a second 3' hybridization moiety having a hybridization nucleotide sequence complementary to the target nucleic acid; p, q and r represent the number of nucleotides, and X, Y and Z are deoxyribonucleotides or ribonucleotides; the Tm of the first 5' hybridization portion is higher than that of the second 3' hybridization portion and the separating portion has the lowest Tm in all three portions; the separating portion separates the first 5' hybridization portion from the second 3' hybridization portion in terms of hybridization events to the target nucleic acid, whereby the hybridization specificity of the oligonucleotide is doubly determined by the first 5' hybridization portion and the second 3' hybridization portion such that the total hybridization specificity of the oligonucleotide is increased.
[0026]
26. Method according to claim 23, characterized in that it further comprises the repetition of steps (a) - (c) or (a) - (d).
[0027]
27. Method according to claim 23, characterized in that it is carried out on a solid phase; wherein the first probe is immobilized by its 5' end to the surface of a solid substrate and the second probe is not immobilized.
[0028]
28. Method according to claim 23, characterized in that it is carried out on a solid phase; wherein the second probe is immobilized by its 3' end to the surface of the solid substrate and the first probe is not immobilized.
[0029]
29. Method according to claim 23, characterized in that the target nucleic acid sequence comprises at least two types of nucleic acid sequences and the first probe and the second probe each comprise at least two types of probes.
[0030]
30. Method according to claim 23, characterized in that the target nucleic acid sequence comprises a nucleotide variation, the nucleotide variation in the target nucleic acid sequence is present at a site as opposed to the second portion of 5' hybridization of the TD probe, and the TD probe presents a sequence corresponding to the nucleotide variation in its second 5' hybridization portion.
[0031]
31. Method for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe (TD probe), characterized in that it comprises the steps of: (a) hybridization of the target sequence of nucleic acids with the TD probe having a hybridizing nucleotide sequence complementary to the target nucleic acid sequence; wherein the TD probe has a modified dual specificity oligonucleotide (mDSO) structure represented by the following general formula I: 5'-X'p-Y'q-Z'r-3' (I) where, X'p represents a second 5' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Y'q represents a separation portion comprising at least three universal bases, Z'r represents a first 3' hybridization portion having a hybridization nucleotide sequence complementary to the target nucleic acid sequence; the TD probe is labeled with a fluorescent reporter molecule on the second 5' hybridization moiety; p, q and r represent the number of nucleotides; and X', Y' and Z' are deoxyribonucleotides or ribonucleotides; the Tm of the second 5' hybridization portion is lower than that of the first 3' hybridization portion and the separation portion has the lowest Tm in the three portions of X'p, Y'q and Z'r; the length of the second 5' hybridization portion is 3-15 nucleotides, the length of the first 3' hybridization portion is 15-60 nucleotides, and the first 3' hybridization portion is longer than the second 5' hybridization portion ; the separation portion separates the second 5' hybridization portion from the first 3' hybridization portion in terms of hybridization events to the target nucleic acid sequence, whereby the hybridization specificity of the TD probe is doubly determined by the second hybridization portion 5' and the first hybridization portion 3' such that the total hybridization specificity of the TD probe is increased; wherein when the TD probe is hybridized to the target nucleic acid sequence, both the second 5' hybridization moiety and the first 3' hybridization moiety will hybridize to the target nucleic acid sequence to induce a change in the fluorescence of the fluorescent reporter molecule; wherein when the TD probe is hybridized to the non-target nucleic acid sequence, both the second 5' hybridization portion and the separating portion will form a single strand so as not to induce modification in the fluorescence of the fluorescent reporter molecule, whereby the TD probe allows to discriminate target nucleic acid sequence from non-target nucleic acid sequence; and (b) detecting the fluorescence modification, such that the fluorescence modification is indicative of the presence of the target nucleic acid sequence.
[0032]
32. Method according to claim 31, characterized in that step (a) is performed using the TD probe in conjunction with an antisense primer and a template-dependent nucleic acid polymerase such that the target sequence of Nucleic acids hybridizable to the TD probe is further generated to increase the fluorescence modification indicative of the presence of the target nucleic acid sequence.
[0033]
33. Method according to claim 31, characterized in that step (a) is performed using the TD probe together with a pair of primers composed of two primers as a forward primer and an antisense primer and a template-dependent nucleic acid polymerase such that the target nucleic acid sequence hybridizable to the TD probe is amplified by PCR to increase the fluorescence modification indicative of the presence of the target nucleic acid sequence.
[0034]
34. Method according to claim 31, characterized in that the TD probe is additionally labeled with a suppressor molecule capable of quenching the fluorescence of the reporter molecule.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112012008102B1|2021-05-04|distinctive target probe | and methods for detecting a target DNA nucleic acid sequence or a mixture of nucleic acids using a distinctive target probe |

---

AU2010336137B2|2015-08-06|TSG primer target detection

---

BR122019022348B1|2021-05-11|method and kit for detecting a target nucleic acid sequence of a DNA or a mixture of nucleic acids through a ptocean assay

---

US9328377B2|2016-05-03|Detection of target nucleic acid using a target hybridization and detection primer

---

JP6529934B2|2019-06-12|Detection of target nucleic acid sequences by PO cleavage and hybridization

---

AU2013371128B2|2017-08-10|Detection of target nucleic acid sequence by PTO Cleavage and Extension-Dependent Non-Hybridization assay

---

BR112014021993B1|2022-01-11|METHODS AND KITS FOR DETECTION OF A NUCLEOTIDE VARIATION IN A TARGET NUCLEIC ACID SEQUENCE THROUGH A PTOCE ASSAY

---

US20170260576A1|2017-09-14|Td probe and its uses

---

US9850524B2|2017-12-26|Detection of target nucleic acid sequences by PO cleavage and hybridization

---

RU2588457C2|2016-06-27|Determination of target nucleic acid sequences by splitting oligonucleotide probe and hybridisation

同族专利:

---

公开号 | 公开日

---

JP5653437B2|2015-01-14|

---

RU2542478C2|2015-02-20|

---

SG10201405412RA|2014-10-30|

---

IL218406D0|2012-04-30|

---

JP2013503627A|2013-02-04|

---

CA2770588C|2018-07-10|

---

AU2010290277A1|2012-03-08|

---

US20120220468A1|2012-08-30|

---

EP2473634A2|2012-07-11|

---

WO2011028041A2|2011-03-10|

---

WO2011027966A2|2011-03-10|

---

EP2473634A4|2013-07-17|

---

AU2010290277B2|2015-01-22|

---

IL218406A|2017-10-31|

---

BR112012008102A2|2020-10-27|

---

EP2473634B1|2019-05-01|

---

NZ598821A|2014-09-26|

---

MY157531A|2016-06-15|

---

RU2012109893A|2013-10-10|

---

CN102770556B|2016-09-14|

---

CA2770588A1|2011-03-10|

---

SG178350A1|2012-03-29|

---

MX2012002609A|2012-04-02|

---

CN102770556A|2012-11-07|

---

KR101481004B1|2015-01-22|

---

WO2011027966A3|2011-05-19|

---

WO2011028041A3|2011-09-15|

---

ZA201201733B|2013-05-29|

---

KR20120046780A|2012-05-10|

---

CN106434857A|2017-02-22|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US3016A|1843-03-21|Burning bricks |

---

US3996345A|1974-08-12|1976-12-07|Syva Company|Fluorescence quenching with immunological pairs in immunoassays|

---

US4351760A|1979-09-07|1982-09-28|Syva Company|Novel alkyl substituted fluorescent compounds and polyamino acid conjugates|

---

US4683202B1|1985-03-28|1990-11-27|Cetus Corp|

---

US4683195B1|1986-01-30|1990-11-27|Cetus Corp|

---

US4800159A|1986-02-07|1989-01-24|Cetus Corporation|Process for amplifying, detecting, and/or cloning nucleic acid sequences|

---

US5449602A|1988-01-13|1995-09-12|Amoco Corporation|Template-directed photoligation|

---

US6004826A|1988-07-20|1999-12-21|David Segev|Repair-mediated process for amplifying and detecting nucleic acid sequences|

---

JP3046837B2|1989-03-10|2000-05-29|バイシス・インコーポレーテツド|Immobilized oligonucleotide probes and their use|

---

AU4848393A|1992-09-25|1994-04-26|Abbott Laboratories|Ligase chain reaction method for detecting small mutations|

---

US6077668A|1993-04-15|2000-06-20|University Of Rochester|Highly sensitive multimeric nucleic acid probes|

---

DE69528706T2|1994-08-19|2003-06-12|Pe Corp Ny Foster City|COUPLED AMPFLICATION AND LIGATION PROCEDURE|

---

CA2222744C|1995-05-31|2008-03-25|Amersham Life Science, Inc.|Thermostable dna polymerases|

---

SE506700C2|1996-05-31|1998-02-02|Mikael Kubista|Probe and Methods for Analysis of Nucleic Acid|

---

US6309824B1|1997-01-16|2001-10-30|Hyseq, Inc.|Methods for analyzing a target nucleic acid using immobilized heterogeneous mixtures of oligonucleotide probes|

---

US6013449A|1997-11-26|2000-01-11|The United States Of America As Represented By The Department Of Health And Human Services|Probe-based analysis of heterozygous mutations using two-color labelling|

---

US6140054A|1998-09-30|2000-10-31|University Of Utah Research Foundation|Multiplex genotyping using fluorescent hybridization probes|

---

US7537886B1|1999-06-22|2009-05-26|Life Technologies Corporation|Primers and methods for the detection and discrimination of nucleic acids|

---

DK1715063T3|2000-03-29|2011-05-16|Lgc Ltd|Hydration beacon and method for rapid sequence detection and distinction|

---

US6350580B1|2000-10-11|2002-02-26|Stratagene|Methods for detection of a target nucleic acid using a probe comprising secondary structure|

---

GB0026604D0|2000-10-31|2000-12-13|Roslin Inst Edinburgh|Diagnostic method|

---

US6558907B2|2001-05-16|2003-05-06|Corning Incorporated|Methods and compositions for arraying nucleic acids onto a solid support|

---

US20030165888A1|2001-07-18|2003-09-04|Brown Bob D.|Oligonucleotide probes and primers comprising universal bases for diagnostic purposes|

---

RU2206615C1|2001-10-22|2003-06-20|Институт молекулярной биологии им. В.А. Энгельгардта РАН|Method of partial dna sequencing for detection of mutations in short fragments of single-stranded dna using microchip|

---

US7399590B2|2002-02-21|2008-07-15|Asm Scientific, Inc.|Recombinase polymerase amplification|

---

EP1723255B1|2004-02-17|2010-12-29|Nuevolution A/S|Method for enrichment involving elimination by mismatch hybridisation|

---

WO2006061994A1|2004-12-08|2006-06-15|Takeshi Yamamoto|Method of examining gene sequence|

---

WO2007044057A2|2005-02-24|2007-04-19|The Ohio State University Research Foundation|Methods for quantifying microrna precursors|

---

WO2006095941A1|2005-03-05|2006-09-14|Seegene, Inc.|Processes using dual specificity oligonucleotide and dual specificity oligonucleotide|

---

KR100977186B1|2005-03-05|2010-08-23|주식회사 씨젠|Processes Using Dual Specificity Oligonucleotide and Dual Specificity Oligonucleotide|

---

KR20070052890A|2005-11-18|2007-05-23|주식회사 씨젠|Oligonucleotides for detecting respiratory virus nucleic acids|

---

EP2079754B1|2006-10-04|2017-03-15|Third Wave Technologies, Inc.|Snap-back primers and detectable hairpin structures|

---

KR20080037128A|2006-10-25|2008-04-30|주식회사 씨젠|Method for detecting nucleotide variations|

---

KR100881924B1|2007-03-14|2009-02-04|주식회사 씨젠|Method for Detecting Nucleotide Variations Using Labelled Primers|

---

EP2480689A4|2009-09-24|2013-05-15|Seegene Inc|Detection of target nucleic acid sequences by cyclic exonucleolytic reactions|

---

KR20110050327A|2009-11-07|2011-05-13|주식회사 씨젠|T h d primer target detection|EP2480689A4|2009-09-24|2013-05-15|Seegene Inc|Detection of target nucleic acid sequences by cyclic exonucleolytic reactions|

---

KR20110050327A|2009-11-07|2011-05-13|주식회사 씨젠|T h d primer target detection|

---

EP2619317B1|2010-09-20|2020-09-02|Seegene, Inc.|Detection of target nucleic acid sequences by exonucleolytic activity using single-labeled immobilized probes on solid phase|

---

KR20120042100A|2010-10-22|2012-05-03|주식회사 씨젠|Detection of target nucleic acid sequences using dual-labeled immobilized probes on solid phase|

---

MX340258B|2011-01-11|2016-07-01|Seegene Inc|Detection of target nucleic acid sequences by pto cleavage and extension assay.|

---

CN103534358B|2011-03-29|2015-03-25|Seegene株式会社|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent cleavage|

---

BR112013028296B1|2011-05-04|2020-03-24|Biocept, Inc.|METHODS FOR DETECTION OF NUCLEIC ACID SEQUENCE VARIANTS|

---

MX342067B|2011-05-04|2016-09-09|Seegene Inc|Detection of target nucleic acid sequences by po cleavage and hybridization.|

---

US9850524B2|2011-05-04|2017-12-26|Seegene, Inc.|Detection of target nucleic acid sequences by PO cleavage and hybridization|

---

BR112014002134A2|2011-08-24|2017-02-21|Grifols Therapeutics Inc|polynucleotide, composition, method for determining the presence of a target nucleic acid in a sample, and kit|

---

GB201116131D0|2011-09-19|2011-11-02|Epistem Ltd|Probe|

---

KR20130101952A|2012-02-02|2013-09-16|주식회사 씨젠|Detection of target nucleic acid sequence by pto cleavage and extension-dependent hybridization|

---

EP2770065B1|2013-02-25|2017-12-13|Seegene, Inc.|Detection of nucleotide variation on target nucleic acid sequence|

---

JP5976849B2|2012-03-05|2016-08-24|シージーン アイエヌシー|Detection of nucleotide mutations in target nucleic acid sequences by PTO cleavage and extension assays {Detection of Nucleotide Variation on Target Nucleic Acid Sequence PTO Cleavage and Extension Assay}|

---

US9683259B2|2012-04-19|2017-06-20|Seegene, Inc.|Detection of target nucleic acid sequence by PTO cleavage and extension-dependent signaling oligonucleotide cleavage|

---

AU2013292706B2|2012-07-17|2018-12-20|Co-Diagnostics, Inc.|Cooperative primers, probes, and applications thereof|

---

US20140038182A1|2012-07-17|2014-02-06|Dna Logix, Inc.|Cooperative primers, probes, and applications thereof|

---

WO2014124290A1|2013-02-07|2014-08-14|Rutgers, The State University Of New Jersey|Highly selective nucleic acid amplification primers|

---

EP3022319A4|2013-07-15|2017-03-22|Seegene, Inc.|Detection of target nucleic acid sequence by pto cleavage and extension-dependent immobilized oligonucleotide hybridization|

---

KR102126031B1|2013-07-23|2020-07-08|삼성전자주식회사|Method for detecting nucelic acids containing a genetic variation|

---

CN105705657B|2013-10-18|2020-07-28|Seegene株式会社|Detection of target nucleic acid sequences in solid phase based on pto cleavage and extension analysis using hybrid-capture and templated oligonucleotides|

---

WO2015071552A1|2013-11-18|2015-05-21|Teknologian Tutkimuskeskus Vtt|Multi-unit probes with high specificity and a method of designing the same|

---

US9297033B2|2013-12-13|2016-03-29|Roche Molecular Systems, Inc.|Detecting single nucleotide polymorphism using hydrolysis probes with 3′ hairpin structure|

---

GB201415674D0|2014-09-04|2014-10-22|Moorlodge Biotech Ventures Ltd|Nucleic acid analysis|

---

EP3241900B1|2014-12-19|2020-07-08|Eiken Kagaku Kabushiki Kaisha|Oligonucleotide probe for detecting single nucleotide polymorphism, and method for detecting single nucleotide polymorphism|

---

WO2016137031A1|2015-02-25|2016-09-01|다이오진|Dumbbell-structure oligonucleotide, nucleic acid amplification primer comprising same, and nucleic acid amplification method using same|

---

CN105368943B|2015-11-21|2018-10-16|中国人民解放军第三〇九医院|A kind of kit and method for identification of mycobacterium strain|

---

EP3548634B1|2016-12-02|2021-02-24|CONGEN Biotechnologie GmbH|Probe for detection of snps|

---

RU2665631C2|2017-01-25|2018-09-03|Общество с ограниченной ответственностью "Секвойя Дженетикс"|Method of specific identification of dna sequences|

---

US20200270679A1|2017-09-29|2020-08-27|Seegene, Inc.|Detection of target nucleic acid sequences by pto cleavage and extension-dependent extension assay|

法律状态:
2020-11-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2020-11-17| B06U| Preliminary requirement: requests with searches performed by other patent offices: procedure suspended [chapter 6.21 patent gazette]|

---

2021-03-30| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2021-05-04| B16A| Patent or certificate of addition of invention granted|Free format text: PRAZO DE VALIDADE: 10 (DEZ) ANOS CONTADOS A PARTIR DE 04/05/2021, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

KR10-2009-0083196|2009-09-03|

---

KR20090083196|2009-09-03|

---

PCT/KR2010/004119|WO2011027966A2|2009-09-03|2010-06-24|Td probe and its uses|

---

KRPCT/KR2010/004119|2010-06-24|

---

PCT/KR2010/005971|WO2011028041A2|2009-09-03|2010-09-02|Td probe and its uses|

---